ZuoTi.Pro
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
E. coli makes curli fibers on its cell surface that are bacterial amyloid proteins. These curli...
An organism has a diploid chromosome number of 8. The paternal chromosomes differ from the maternal...
please type and answer all the question Why Isn’t My Antibiotic Working? Part I Your throat...
Answer all of the following questions to get full credit for the assignment. No late assignments...
How do multienzyme complexes in the cell, such as the fatty acid synthase, enhance reaction rates?...
1.) Internal fertilization is a major feature of vertebrates that has allowed the group to be...
IV. MONOHYBRID, SEX-LINKED PROBLEMS 10. In humans, as well as in other primates, sex is determined...
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which...
After digesting PKB200 and PKB201 plasmids you are expected to see two bands on the gel....
What other features of pGap besides the GAPC gene can you infer have been bioengineered in...
Please use short essay format to respond. 1. The tail on the Ascaphus frog. What evolutionary...
what is the mathematical model that can be used to describe the intraspecific competition, and why?
Cells posses mechanisms to ensure that mis-folded proteins do not accumulate in the ER. Describe these...
Which viral replication doesn’t result in the death of a cell?
if a mammalian cell shows one or more Barr bodies, what is the most likely sex...
Compare and contrast the roles of oncogenes and tumor suppressors in oncogenesis. How were each discovered...
1. During the extraction process, the protein samples must be kept on ice. Why? 2. What...
1). Answer the following: A). Diethylstilbestrol (DES) was used to help maintain pregnancy. The results were...
Roger and Gayle are both of normal phenotype but have a son with Muscular Dystrophy, a...
State the physical and behavioral consequences associated with a GTP-binding protein when it undergoes GTP hydrolysis?
How do ROS or other reactive species start the apoptosis process via the mitochondria
Which best describes how to estimate heritability? (a.) The regression slope of mean offspring phenotype versus...
Regarding biotechnology/biomanufacturing, do cGMPs represent only the views of the FDA?
Hemolytic disease of the newborn A) involves ABO blood groups. B) involves IgM crossing the placenta....
Ten grams of ground beef are added to 90mL of sterile DI water and blended thoroughly...
compared to Fst and assignment methods like STRUCTURE and ADMIXTURE that treat each locus independently (referred...
How I can make a liquid mix yo simulate blood. What essencial susbtances including metabolic waste...
A. You have been given a tube of E. coli. You are asked to make 1...
Describe in detail two ways in which transcription of the trp operon (containing genes used for...
A mixture containing four proteins with native molecular weights: 120 kDa, 100 kDa, 40 kDa, and...
1. Apply the First and Second Law of Thermodynamics to the combustion of glucose and draw...
After going through all the activities, conclude your write up by addressing these two questions. A)interactions...
One of the major issues that Darwin struggled with was the mechanism of how variations were...
The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a...
A gene has four alleles, A1, A2, A3, and A4. The alleles occur in a population...
A child's mother has type A blood. Their father has type B blood. The child has...
How can a biologist determine whether a thing is living or nonliving? Discuss the major characteristics...
For the tertiary structure of proteins in an aqueous/polar environment, hydrophobic amino acids are located on...
what is the largest ecosystem in the planet ? a) the great barrier reef b)the intertidal...
How are yeast and molds different both macroscopically and microscopically
Choose three important ideas/concepts in microbiology, and explain why you chose them as important. For each concept...
Why don't all x-linked genes demonstrate the gene dosage effect? Answer in terms of protein levels...
The anti-angiogenic drug Avastin works by binding to and inhibiting the activity of A. VEGF. B....
1. Compare and contrast acquired immune deficiency syndrome and primary immune deficiency. Make sure I can...
Maria has classic hemophilia, an x-linked recessive disease. Could Maria have inherited the gene for this...
What is a caregiver? What do you bring to the early childhood setting as a caregiver?
How is the treatment (azithromycin) for a non-lethal ocular disease (trachoma) affecting mortality in children? Discuss...
1) (3 pts) Short hair in rabbits is governed by a dominant allele L and long...
The offspring of first cousins have an increased chance of combining the same, sometimes deleterious, allele...
How do I use the genetic code to determine the exact codon for an amino acid?...
Consider the structure of alanine in its fully protonated state with a +1 charge. Alanine has...
Describe the process that allow Gram-positive bacteria to be tolerant to harsh environmental conditions. Explain why...
Name three advantages that a seed provides to seed plants that more primitive seedless plants lack
1. The following diagram shows the genetic map for a chromosome. A B C D 10cM...
1.How does the genetic code in the DNA get passed on to the mRNA?
Answer the following questions: A. Name the flower that typically appears first in the Spring and...
A recent cold case was solved involving DNA evidence that identified Arthur Rudy Martinez as the...
Class: Industrial Ecology PATAKI_et_al-2006-Global_Change_Biology Urban ecosystems and the North American carbon cycle 11. What is the...
when Clover seeds are coated with bacteria What does this bacteria do for the clover and...
In response to an apoptotic stimulus, initiator caspases a. degrade procaspases. b. cleave a transcription factor...
Assume that the two UGG codons in the leader sequence of the trp operon are changed...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...
For questions 4-5 assume cytoplasmic male sterility without genetic fertility restoration. What will be the pollen...
The following question is for Cellular and Molecular Biology lab. What is bradford assay. Which dye...
dwraw three concept maps for any body systems in the Human body focusing on three core...
Create a chart: with at least 10 characteristics (more will help you next week).The characteristics must...
30. Which cellular component below is surrounded by a single phospholipid bilayer? A) one cisternae of...
Tell a common property and a different property between each of the following pairs - talk...
4. a) Discuss on RNA editing and its impact in cephalopods. (10 Marks) b) Following 5...
Rabies has a — strand (antisense) RNA for its genome. Describe biosynthesis of this virus including...
Chargaff discovered that the A-T bond has the same width as the G-C bond. What implication...
Drosophila has four recessive genes on four different chromosomes (the fact that they are on different...
Part 1 You have been hired as a consulting microbiologist to help a wildlife ecologist understand...
Plant Structure – internal and external 1) You are given part of a plant that was...
What does it mean if an organism is "antibiotic resistant"? Why/how is this a modern day...
Describe the concept of transcriptional switches and why they are required in prokaryotic and eukaryotic systems.
Discuss possible reasons why transcriptional regulation or post-transcriptional regulation may have evolved for different types of...
What do you expect to see in the largest quantities during a viral infection? a. Basophils....
Draw imprints of stoma of upper epidermis of leaf
1)How many microliters of original sample are required to produce a final dilution of 10-2 in...
‹
1
2
3
4
5
6
7
8
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
ADVERTISEMENT
Active Questions
1. (a) When a battery is connected to the plates of a 6.00-µF capacitor, it stores...
asked 48 minutes ago
A gas reservoir has the following characteristics: A= 3,000 acres h= 30 ft ? = 0.15...
asked 1 hour ago
2. A television network executive has a list of 7 sitcoms and 5 reality shows to...
asked 1 hour ago
LawVIEW Question: As you saw in your second-order system experiments, your systems oscillate to a change...
asked 2 hours ago
consider the titration of 50mL of 1.5 M HCOOH with .50 M NaOH. Ka= 1.8x10^-4 &...
asked 3 hours ago
"provide products and mechanisms for (z)-3,4-dimethyl-2-pentene reaction with Br2 in H2o including stereochemisty"
asked 5 hours ago
FOR the regular expression r= (a+b)*abb (1) Find the NFA without ε-moves for r. (2) Convert...
asked 5 hours ago
what are the moles of, 1.87 g SiO2, 0.95 g NH4Cl, and 2.46g NaCl?
asked 5 hours ago
Transaction costs, as they relate to dividend policy, A) include the costs of brokerage fees. B)...
asked 5 hours ago
Which of the following is a true statement about inpatriates? A. Inpatriates are foreign employees who...
asked 5 hours ago
I've written this program in C++ to compare 2 pizzas using classes and it works fine....
asked 5 hours ago
Assume the following information: Work-in process, beginning 100 units, 25% complete Units completed and transferred out...
asked 5 hours ago
ADVERTISEMENT