ZuoTi.Pro
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
During prolonged fasting or the onset of starvation, proteins will eventually be used for energy. Discuss...
A student conducts an investigation in which she dissolves 1 gram (g) each of several substances...
The following is true about protein chaperones except: a. they buffer genetic change by repairing the...
a) Its time to refresh your memory on the different types of DNA mutations. Define the...
1. What is protein structure? 2. Why is it important to know the primary structure? 3....
QUESTION 1 When cells stimulate other cells at long distances, it is referred to as: paracrine...
Describe the features present in a mature eukaryotic messenger RNA (mRNA) and discuss how they facilitate...
genomic DNA extraction proticol queations 1- why is sodium Azide added in wash buffer 2 2-what...
1. During homeostasis what physiological factors need to be balanced within a living organisms
Imagine that you have discovered an enzyme that catalyzes synthesis of asparagine from aspartate and NH3....
What is a challenge that can make it difficult to apply the Phylogenetic Species Concept? Understanding...
Why might you expect facultative anaerobes to accomplish anaerobic respiration in peptone-iron agar deeps when they...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...
In C. elegans, lon-2 and unc-2 are recessive mutations that are 8 map units apart on...
What can explain the phenomenon where two different loci only give a phenotype when they are...
Steve, a 48 year old accountant, exhibits all the symptoms of metabolic syndrome. Briefly name the...
What would have happened if we had adjusted the pH of our IDH extract to 4.5...
A chromosome’s gene sequence that was ABCDEFG before damage and ABCFG afterward is an example of
If given 285mL of a diluted glucose solution 0.75% (w/v) that was made by adding 35mL...
You are studying three linked genes in snapdragons. The flower color locus is in the center....
Introductory Assignment: Address the following in a handwritten paragraph of a least 500 words. Hemophilia B
1. birds are most closely evolutionarily related to what other partially marine creatures? crocodilians marine iguanas...
What process requires contact between the donor cell and the recipient cell? A. transformation B. transduction...
Why are non-viral vehicles often lipid based? Describe how cationic liposomes can specifically target DNA.
all these questions have more than one correct answers 1) Meiosis & mitosis have similarities as...
Take three cuvettes from the Containers shelf and place them onto the workbench. Take an Erlenmeyer...
a nurse is reviewing the laboratory values of a group of clients. which of the following...
what are the SMART objectives for substance abuse for collage students
why do large Porcellio scaber move quicker than small P.scaber ( in relation to length)? can...
Permian extinction... Which of the following statements about the Permian extinction is FALSE? A. An estimated...
The 2 kinds of base pairs that make up the 'rungs of the ladder' of DNA...
The Sox2 protein is an early marker of neural tissue. Imagine a researcher removes a region...
Colchicine (a chemical) inhibits separation of sister chromatids in mitosis. Cultured plant cells can be treated...
A single Staphylococcus aureus bacteria cell gets into a wound on your foot. S. aureus divides...
A child with blood type A is born to a mother with blood type B. The...
What are the three components of THF? A. Five carbon structure B. Carbonic acid C. Nitrogenous...
The enzymes responsible for the degradation of sphingolipids are localized in which subcellular structure? A. Peroxisomes...
4. Assuming that the cell cycle lasts 24 hours (1,440 minutes), use these percentages to calculate...
A single strand of RNA could potentially interact with which of the following molecules? Choose one...
Which of the following would you classify as something other than an animal? Select one: a....
Order the following events: ...
Experiment 1: Virtual Microscope Purpose (What question is this experiment designed to answer?): Hypothesis (Based on...
16. Which of the following statements is/are correct? A. The endoskeleton made of Chitin and protein...
In graminoid (grasslike plant) dominated wetlands, shrubs will sometimes encroach in the absence of burning or...
Short Answer Question 9: The Immune System ----------------------------------- Key Concepts/Questions: a) Compare and Contrast Innate vs....
What are the evolutionary adaptations of dermal organs and how do they function?
In soreflies (a hypothetical insect), the dominant allele, L, is responsible for resistance to a common...
Describe the intracellular mechanisms of the following GPCRs, membrane lipid-derived 2nd messengers and RTKs.
Three of the following characteristics would be expected to have evolved together, but one does not...
Briefly describe how cells determine whether or not to express genes in the his operon. Be...
There are a number of adaptations required for life to exist on land. Identify and describe...
A diagnostic test for M. tuberculosis exposure relies on an innate immune response that occurs only...
principle of genetics: chapter 10: describe the synthesis of RNA and the experiments which support your...
A fiber (like pectin) with adsorptive abilities can decrease absorption of fatty acids by a) causing...
The reading for this week includes the following statement: "It is emphasized that scientists, through their...
Calculate the number of ATP produced from the complete oxidation of myristic acid. Each round of...
If three neurotransmittors bind to a normal neuron at resting Vm on the dendrites.. 1st neurotransmittor:...
Identical twins are derived from a single egg and fertilized by a single sperm, creating a...
Regarding aerobic respiration, what molecules need transport assistance? What mechanism of transport is used and what...
Which of the following are characteristics of a typical kinesin motor? Select all that apply. moves...
Why is PCR required before running the DNA on a gel? A Without PCR, there would...
Explain how the bird and mammal myogenic hearts keep beating.
One allele of the APOE gene is associated with early Alzheimer’s disease, while another allele appears...
6. A series of proteins of known mass were running over a Sephacryl S300 column. A....
How does a Natural Killer cell decide whether or not to kill a cell? And how...
Trepomema Pallidum , Clostridum tatani, Klebsillapneumonia and Bacilluis all share what paraparties A- having phpspolipids in...
Hello I need help with these questions based on the table. Thanks Table: Name Type Blood ...
1. what is the thermodynamic force of the enzyme to bind a substrate? elaborate by using...
How does a ribosome identify mRNA for translation from the rest of the RNA species in...
Identify and summarize all of the different roles of bacteria in the nitrogen cycle. What are...
List 5 epidemiological environmental factors that affect vector biology and behavior.
How is an understanding of meiosis required to work Mendelian genetics problems? Explain in terms of...
explain the two major processes that drive the normal functioning of the carbon cycle, and then...
Left-right asymmetry is associated with higher levels of the TGF-B family signaling molecule Nodal on the...
Need need one of these question for biochemistry Where do the electrons required to introduce a...
Applying the theory of island biogeography to habitat fragmentation, what would be the best suggestion conservation...
One of the features that separates E. Coli from closely-related species is it’s ability to ferment...
What is the significance of the secretion “signal peptide” (or secretion signal sequence)? What is it...
G alpha z (Gaz) is a protein of 355 amino acids in length. It is synthesized...
how does body organization complexity relate to body shape/size and physiological exchange with the environment?
‹
1
2
3
4
5
6
7
8
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
ADVERTISEMENT
Active Questions
"provide products and mechanisms for (z)-3,4-dimethyl-2-pentene reaction with Br2 in H2o including stereochemisty"
asked 1 hour ago
FOR the regular expression r= (a+b)*abb (1) Find the NFA without ε-moves for r. (2) Convert...
asked 1 hour ago
what are the moles of, 1.87 g SiO2, 0.95 g NH4Cl, and 2.46g NaCl?
asked 1 hour ago
Transaction costs, as they relate to dividend policy, A) include the costs of brokerage fees. B)...
asked 1 hour ago
Which of the following is a true statement about inpatriates? A. Inpatriates are foreign employees who...
asked 1 hour ago
I've written this program in C++ to compare 2 pizzas using classes and it works fine....
asked 1 hour ago
Assume the following information: Work-in process, beginning 100 units, 25% complete Units completed and transferred out...
asked 1 hour ago
what was responsible for factory reforms and improved safety working conditions? The triangle fire, the jungle,...
asked 1 hour ago
In 2009, the average starting salary for an individual right out of college with a bachelor’s...
asked 1 hour ago
An elevator has a placard stating that the maximum capacity is 1550 lb — 10 passengers....
asked 2 hours ago
* This program illustrates how to use a sequential search to find the position of the...
asked 2 hours ago
three kg of gas in a piston-cylinder assembly undergo a process during the relationship between pressure...
asked 2 hours ago
ADVERTISEMENT