ZuoTi.Pro
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
how mycobacterium tuberculosis and related species are able to resist common disinfectants . please help with...
5. Mendel’s Law of Independent Assortment does not always hold true. As explained very briefly in...
What is TBST? a. why is it used? b. Purpose of rinsing and washing steps
Why were organisms formerly called “blue-green algae” recently moved to a different Kingdom?
From the following classes of proteobacteria listed, choose one from below to create a dichotomous key....
Excretion by arthropods involves a variety of structures that differ from excretory systems in annelids. Explain.
A patient on your unit with bacterial meningitis has a temperature of 102.6 F. You know...
what is the difference between the functioning of GLUT4 transporter in skeletal muscle cells whereas the...
Discuss the following about Malaria. Disease caused Mode of transmission Virulence factors Diagnostic methods
Mexican cave-dwelling fish have evolved reduced eye size and other morphological traits associated with living in...
Light reactions: what's the relationship of the nature of sunlight and photosynthetic pigments Understand the relationship...
Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would...
Which of the following liver enzymes are involved in the production and/or release of glucose into...
6. About 70% of Americans get a bitter taste from the substance called phenylthiocarbamide (PTC). It...
1)List 3 proteins found in hen egg white and state their functions 2)Will brown egg white...
What is the Cas-9 CRISPR system? Include both where it originated in nature, and how it...
Agriculture has experienced dramatic transformation over the past 50 years as it has become increasingly industrialized...
What problems might one encounter in such a calibration? Select the four correct answers. the same...
Which drug works by disrupting synthesis of the bacterial cell wall? Multiple Choice sulfonamide penicillin polymixin...
an experiment was carried out for bacterias from the nose the other sample was from the...
Describe the mechanism of pathogenesis of staphylococcus Aureus, and the implications of presence/absence of the pathogen...
what structure gives rise to the umbilical blood vessels?
An increase in alcohol dehydrogenase is associated with which of the following? A) All of the...
Write T/F -specificty of an antibody binding is true to ONE antigen only -papain cleave of...
Chemical energy is most often released by ________. A. reorganizing molecules with each other B. creating...
Consider that the zebrafish microbiome has more than just two bacterial strains within it. How do...
Come up with a hypothesis why a certain mutation is more likely to occur in male...
If the duodenal ampulla is blocked, what materials cannot be released into the lumen of the...
43. According to the Los Angeles County Museum, what is the accession number of Seated figure...
True or False Chronic ethanol ingestion alters carbohydrate metabolism and leads to a fatty liver due...
Discuss how we can put microbes to work to facilitate our lives: from keeping our landscape...
What is the purpose of the AMES test ? Why is liver homogenate used ? If...
Shine-Dalgarno (SD) has a role in translation by binding to the 16S ribosomal RNA. What would...
the principe of dominance states that 1. the dominant train shows up at least 50% of...
In types of gene mapping (the main two linkage and physical) Are FISH, Radiation hybrid, chromosomal,...
Water is one of the most important compounds for life because of many properties. Identify one...
When performing a presumptive test with a water sample, you typically use a lactose broth with...
In a shark, what structures open into the cloaca?
Why does co-contraction (contraction of all motor neurons at the same time) lead to paralysis and...
For an immunocytochemical experiment in which you labeled tissue with two primary antibodies (one made in...
If a cell is able to use both aerobic and anaerobic respiration, it can regenerate ____________...
The following are ABO phenotypes from a population sample of one hundred persons. The number of...
Which of the following is a hall mark of a state function? Select one: a. Its...
Describe and explain what would happen to the shape growth curve (what phase, the slope, etc)...
What is the purpose Pfaffl equation ? what does the result of the equation tells us...
Compare the activities of E. coli DNA polymerase III and RNA polymerase by describing the following...
In your home, a thermostat monitors the ambient temperature. If the ambient temperature drops below a...
Restoration ecology is ultimately to help with the future of organisms to increase biodiversity. True False
Which statement about pseudogenes is true? In some gene families, there appears to be little selection...
Flagellar phase variation occurs in Salmonella and involves several genes and DNA sites. Several different mutations...
The product of glycogenolysis enters glycolysis: what is the net ATP yield under anaerobic conditions? 32...
What benefit is derived from the mutualism of bacteria and legumes?
The minimum inhibitory concentration, or MIC, refers to the minimum concentration of a chemical that is...
Which statements are true and which statements are false? Question Selected Match Electrophoresis works by running...
If a disorder is caused by a single gene, can one conclude that only one phenotype...
where RNA molecules used as catalyst also why and reasons
Micro the unknown report Help! My unknown is gram+ cocci, endospore-forming, and then I went to...
You are breeding chickens and your friend gives you a grey chicken with yellow legs and...
Discuss the various immune, biochemical and physiological mechanisms that may bring insulin resistance about and explain...
Topic: Psychopharmacology . Why are Serotonin and Norepinephrine Reuptake Inhibitors (SNRIs) contraindicated to use with MAOIs?
Janet, age 19, is a college student. She is not eating or sleeping well, and she...
what are the two factors prompted colonies to shift slave labor?
How can dissolved materials be moved from the outside to the inside of a cell when...
____ is the process by which something that is not otherwise recognized as a pathogen is...
Match each flower part to its correct description. - A. ...
27. Hydrolysis of ________in an actin filament reduces the strength of binding between the monomersand _________the...
1. Human microbiota. What type of bacteria species are likely to be cultured from your throat...
why are sulphate reducing bacteria common in marine sediments?,which are two major electron donors for SRB....
Give two examples of protein assemblies used by plants in the translocation of solute particles.
COVID 19 is a positive sense single stranded RNA virus. Which of the following is the...
Which of these is a major chemical difference between DNA and RNA? Group of answer choices...
A food product contains 1 x 106 CFU/g of Escherichia coli. Heating at 80 C for...
For each, write out the expected amino acid sequence. i. AUGAGGAGUGUUCAACUUUCGAGGGGCGAU ii. AUGAGCAGUGUUUAACUUUCGAGGGGCGAU
10. The age of the reptiles, the Mesozoic era, is marked by the rise of the...
The E. coli strain H104:O4 caused the 2011 outbreak in Germany. This strain encodes several virulence...
Intelligent design theory is an argument used by some people to challenge the teaching of evolution...
In Biology of Microorganisms, we are going to be doing an Isolation project. Please explain to...
What can be the reason(s) for a change in allele and genotype frequencies in a population?...
1. Duloxetine was approved for pain relief in osteoarthritis in 2010. Find a study that supports...
Which of the following cellular organelles is the site of translation during protein synthesis? A. Cell...
‹
1
2
3
4
5
6
7
8
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
ADVERTISEMENT
Active Questions
Topic: Poverty and its solution 1. Introduction (50 words) 2. Causes of Poverty (150 words) 3....
asked 37 minutes ago
Leaky Pipe, a local retailer of plumbing supplies, faces demand for one of its SKUs at...
asked 45 minutes ago
Assign costs -- In August , Jay Corp determined its cost per equivalent units in department...
asked 1 hour ago
A photon is emitted when a hydrogen atom undergoes a transition from the n = 8...
asked 2 hours ago
A metal wire of diameter 1.00 mm can support a tension of 0.250 kN. A construction...
asked 2 hours ago
If 5.0 Liters of a gas is allowed to expand against a pressure of 1.10 atm...
asked 2 hours ago
Are the actions undertaken by the companies or individuals in the following scenarios legal or illegal...
asked 4 hours ago
A quantum mechanical transition between two rotational energy levels is measured between E0 = 3.6x10-23 J...
asked 4 hours ago
Inside a radiation therapy device, an electron is in the presence of a uniform electric field...
asked 4 hours ago
Question 1) Assume that the heights of American men are normally distributed with a mean of...
asked 4 hours ago
1. In a test to compare the effectiveness of two drugs designed to lower cholesterol levels,...
asked 4 hours ago
4. A buffer was made with ammonia concentration 0.2 M and ammonium sulfate 0.05M. Calculate the...
asked 4 hours ago
ADVERTISEMENT