Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends. What base should follow the
SauA site to reconstitute a BamHI site after ligation?(5 pts)
2) Assume that there are equal amounts of the four bases (A, C, G, and T) and the bases are randomly distributed in the genome. Calculate the probability to reconstitute both BamHI sites when a random DNA fragment digested by SauA is cloned into a plasmid linearized with BamHI.(5 pts)
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then...
You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there...
You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there is no AvrII site in the multiple cloning region of this plasmid. What other restriction enzyme could you use to cut the plasmid’s multiple cloning region that would produce compatible ends for ligation with your genomic DNA? (Hint: Look up the Compatible Cohesive Ends chart at New England Biolabs website and confer with pBluescript map) (1 point)
Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2:...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, dige...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
A genetics problem covering chapter 10 concepts. Could really use some help! The Notch gene, involved...
A genetics problem covering chapter 10 concepts. Could
really use some help!
The Notch gene, involved in Drosophila development, is contained within a restriction fragment of Drosophila genomic DNA produced by cleavage with the enzyme SalI. The restriction map of this Drosophila fragment for several enzymes (Sall, PstI, and Xhol) is shown here; numbers indicate the distances between adjacent restriction sites. This fragment is cloned by sticky-end ligation into the single Sall site of a bacterial plasmid vector that is...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are t...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
Can someone please help me answer these? Neat work is greatly appreciated. Explanation will also be...
Can someone please help me answer these? Neat work is greatly
appreciated.
Explanation will also be appreciated (optional, if you have
time).
Thank you so much! I will give a big thumbs up :)
(1) You start with the pUC18 plasmid that is a -2.7 kb circular DNA molecule. The multiple cloning site (i.e., polylynker) has unique restriction sites in the following order: HindIII, BamHI, EcoRI. Recall that unique restriction site means that these sites are only found once on...
1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see...
1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see on the gel? 2. How would you estimate the total number of base pairs in a plasmid by looking at the DNA fragments of the digested plasmid on a gel? 3. If a linear 1kb DNA fragment has a restriction site that is located 50 bp from one end of the plasmid, what would you expect to see if the digested and undigested DNA...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
A genetics problem covering chapter 10 concepts. Could
really use some help!
The Notch gene, involved in Drosophila development, is contained within a restriction fragment of Drosophila genomic DNA produced by cleavage with the enzyme SalI. The restriction map of this Drosophila fragment for several enzymes (Sall, PstI, and Xhol) is shown here; numbers indicate the distances between adjacent restriction sites. This fragment is cloned by sticky-end ligation into the single Sall site of a bacterial plasmid vector that is...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
Can someone please help me answer these? Neat work is greatly
appreciated.
Explanation will also be appreciated (optional, if you have
time).
Thank you so much! I will give a big thumbs up :)
(1) You start with the pUC18 plasmid that is a -2.7 kb circular DNA molecule. The multiple cloning site (i.e., polylynker) has unique restriction sites in the following order: HindIII, BamHI, EcoRI. Recall that unique restriction site means that these sites are only found once on...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
Most questions answered within 3 hours.
-
A shotputter throws the shot with an initial speed of 15.8 m/s
at a 38.0 ∘...
asked 22 seconds ago -
Debra and Merina sell electronic equipment and supplies through
their partnership. They wish to expand their...
asked 1 minute ago -
How does a linear regression allow you to better estimate
trends, costs, and other factors in...
asked 9 minutes ago -
1. (15%) Describe the difference between a pull (Kanban), push
and CONWIP production systems.
asked 5 minutes ago -
QUESTION 5
The total area under the Z distribution curve is equal to:
a.
10
b....
asked 14 minutes ago -
Using Python
The variables x and y refer to numbers. Write a code segment
that prompts...
asked 28 minutes ago -
If
the coefficient of static friction between a box and the floor is
0.35 with what...
asked 30 minutes ago -
A die is designed to punch holes with a radius of 1.08 10-2 m in
a...
asked 35 minutes ago -
government can increase import through
a. export subsidies
b. tax breaks
c. increase import tax
d....
asked 35 minutes ago -
Draw the following in the proper skeletal structure or line
angle formula.
5,6,6-tribromo-3,8-dicyclopropyl-7-isopentyldodecane
asked 41 minutes ago -
Two blocks of masses m1 and m2 hang at the ends of a string that
passes...
asked 41 minutes ago -
Linear programming is an excellent technique yet is not applied
nearly enough in the “real world.”...
asked 51 minutes ago