how do you solve this? em sets: Compute the weakest precondition for the following sequence of...

Question

Question

how do you solve this?

Answer 1

Answer #1

Soli To compute the weakest precondition in Gilven Statement A = 3* (3# bta); → 0 b=2-1 - @ {625} → from @ bos b = 2*a-l; b>s

Answer 2

Similar Homework Help Questions

Compute the weakest precondition for each of the following assignment statements and postconditions: a = 2...

Compute the weakest precondition for each of the following assignment statements and postconditions: a = 2 * (b - 1) - 1 {a > 0} b = (c + 10) / 3 {b > 6} Prove that the following grammar is ambiguous (show 2 trees): <S> → <A> <A> → <A> + <A> | <id> <id> → a | b | c
3. Find the weakest precondition for the following sequence of statements and its post-condition: a-2b +...

3. Find the weakest precondition for the following sequence of statements and its post-condition: a-2b + 1; b = a - 3; {b > 2)
Compute the weakest precondition for the following statements A. if (x == y) x=x*3 else x=x+1...

Compute the weakest precondition for the following statements A. if (x == y) x=x*3 else x=x+1 {x < 0} B. x = 3 * (y + x); y= 3*x ; {y > 6}

2. (8 points) A sequence of statements is listed below: b = (a+4)/2 c=2* b-5 d...

2. (8 points) A sequence of statements is listed below: b = (a+4)/2 c=2* b-5 d = 3*c+ 7 {d>4} calculate the weakest precondition of the sequence.
2. Consider the following grammar: <assign> à <id> = <expr>

2. Consider the following grammar: <assign> à <id> = <expr> <id> à A | B | C <expr> à <id> + <expr> | <id> * <expr> | ( <expr> ) | <id> Show a parse tree and leftmost derivation for the following statements: (a) A = ( A + B ) * C (b) A = A * ( B + C ) 3. [10 Points] Show that the following grammar is...
2. (15 marks) Consider the following program: >> Precondition: x and y E Z. Postcondition: Return...

2. (15 marks) Consider the following program: >> Precondition: x and y E Z. Postcondition: Return the sum x + y. add(x, y): 1. if x == 0: 2. return y 3. elif x > 0: 4. return add(x - 1, y) + 1 5. else: 6. return add(x + 1, y) - 1 Prove that this program is correct in terms of its specification.

How do you seal sequence 2 (from 5'end) to the 3' end of the sequence 1...

How do you seal sequence 2 (from 5'end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAG ACAGAATTGACATATAGGCGATGCTAGT3 Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCG GCTAGATATAACAGGTCCTGAATCGCTA3
Let a sequence Xo, X1,X2,... be defined in the following way: X12 1) Compute the first...

Let a sequence Xo, X1,X2,... be defined in the following way: X12 1) Compute the first 10 terms of this sequence. (2 points) 2) Prove that this sequence is strictly increasing, .e., Vn 20:X >X. (2 points) 3) Prove that Vn 20: Xn S4". What are the base cases? What is the inductive step? (5 points) 4) The above result suggests that this sequence grows in the worst case exponentially, i.e., X 0(4). Consider trying to tighten this bound in...
Please solve with solution. Answer is provided 9. Consider the following four sets of functions: How...

Please solve with solution. Answer is provided 9. Consider the following four sets of functions: How many sets are linearly dependent? A. 0 B. 1 C. 2 D. 3 E. 4 Correct Answer is C

ework Sets Mult: Problem 7 Problern 7 Settings Previous Problem List Next (3 points) Problems A...

ework Sets Mult: Problem 7 Problern 7 Settings Previous Problem List Next (3 points) Problems A bit is a digit which can be either 0 or 1. A bit string is a sequence of bits. The length of a bit string is how many bits there are in it. The empty string is the one with zero bits in it (has length zero). lem 1 Hem 2 Tem 3 em 4 em 5 em 6 em 7 (a) How many...