Structure of arg-his-ala protein are draw in attached files.
Isoelectric point of arginine is 10.76 thus it's free amino group present as NH3+ and isoelectric point of alanine is 6.11 thus it's free carboxylic group present as COO- at pH 6.4
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
draw the ionized polypeptide made of Phe-Asp-Cys-Arg at pH 7
Draw the appropriate titration curve for Ala-Arg-Serstarting at a pH of 1 and ending at a pH of 12. Label the pKas and pI. Draw the structures and equilibrium that occur at the buffering regions and equivalence points. Highlight the coplanar atoms in the peptide bonds
Draw structure of this peptide at pH 7 and at pH 11. Ala-Arg-Asn-Asl-Glu-Ser-Gly Asp*
1) Draw the polypeptide: Ser-Gln-His-Ser II) Estimate the net charge of the polypeptide that has the sequence of Glu-His-Trp-Ser-Gly-Leu-Arg-Pro-Gly 1) At pH 7 2) At PH 11 Pka values are given in table 3.2
What is the approximate net charge of the following pentapeptide at pH 10? Arg-Gln-Cys-His-Ala What is the Isoelectric point (pI) of the peptide given above? Use the pKa values given here when needed: Side group/ amino acid pKa Asp 3.9 Glu 4.1 HIs 6.0 Cys 8.4 Tyr 10.5 Lys 10.5 Arg 12.5 C-term 3.5 N-term 9.0
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide b. Calculate the percentage and indicate the charge of the predominant peptide species at pH 6.5. Use the following pKa values: pKa Cys = 8.3, pKa N-terminus = 10.8, pKa His =6.0, pKa Glu = 4.3, pKa Arg = 12.5, pKa C-terminus =2.0 c. What is the charge of the peptide at pH 4.3? d. Draw the chemical structure of the predominant peptide species...
Example question (p. 171). The amino acid sequence of a wild-type protein is Met-His-Ala-Trp-Asn-Gly-Glu–His-Arg The amino acid sequences of two mutants are: Mutant 1: Met-His-Ala-Trp-Lys-Gly-Glu–His-Arg Mutant 2: Met-His-Ala For each mutant, specify the type of mutation that has occurred, using the mutation classification system based on effect to protein function
1. Phe-His-Glu 2. Ala-His-Pro-Lys 3. Ala-Met-Val-Arg Three peptides were obtained from a trypsin digestion of two different polypeptides. In each case, indicate the possible sequences from the given data.
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?