2. Using the reference pk values provided below (assuming that pk values can be applied to...
options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Fill in the blanks for each amino acid Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
TABLE 5.1 PK values for amino acids 2.36 Amino acid Alanine Arginine Asparagine Aspartic acid Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine PK, PK₂ 2.34 9.69 2.17 9.04 2.02 8.80 1.88 9.60 1.96 10.28 2.19 9.67 2.17 9.13 2.34 9.60 1.82 9.17 9.60 9.60 2.18 8.95 2.28 1.83 9.13 1.99 10.60 2.219.15 2.09 9.10 2.83 9.39 2.20 9.11 2.32 9.62 2.36 9.21 5.56. Of the amino acids listed in Table...
(1) The following diagram represents a titration curve of histidine as pH increases; pKa = 1.82 represents the terminal carboxylic acid group. pK, represents the terminal amino group: 6.0 represents the R-group, and pK, E 9.17 7.59 pH 182 3.0 20 10 H (equivalents) At what point on the diagram is histidine predominantly present as the following species? COO A, at pH < 1.82 B. between pH 1.82 and pH 6.0 C) between pH 6.0 and pH 9.17 D. at...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...