Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon.
Translate the following mRNA.
AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA
|
The genetic code |
|||||||
|
UUU |
phenylalanine |
UCU |
serine |
UAU |
tyrosine |
UGU |
cysteine |
|
UUC |
phenylalanine |
UCC |
serine |
UAC |
tyrosine |
UGC |
cysteine |
|
UUA |
leucine |
UCA |
serine |
UAA |
STOP |
UGA |
STOP |
|
UUG |
leucine |
UCG |
serine |
UAG |
STOP |
UGG |
tryptophan |
|
CUU |
leucine |
CCU |
proline |
CAU |
histidine |
CGU |
arginine |
|
CUC |
leucine |
CCC |
proline |
CAC |
histidine |
CGC |
arginine |
|
CUA |
leucine |
CCA |
proline |
CAA |
glutamine |
CGA |
arginine |
|
CUG |
leucine |
CCG |
proline |
CAG |
glutamine |
CGG |
arginine |
|
AUU |
isoleucine |
ACU |
threonine |
AAU |
asparagine |
AGU |
serine |
|
AUC |
isoleucine |
ACC |
threonine |
AAC |
asparagine |
AGC |
serine |
|
AUA |
isoleucine |
ACA |
threonine |
AAA |
lysine |
AGA |
arginine |
|
AUG |
Methionine START |
ACG |
threonine |
AAG |
lysine |
AGG |
arginine |
|
GUU |
valine |
GCU |
alanine |
GAU |
aspartate |
GGU |
glycine |
|
GUC |
valine |
GCC |
alanine |
GAC |
aspartate |
GGC |
glycine |
|
GUA |
valine |
GCA |
alanine |
GAA |
glutamate |
GGA |
glycine |
|
GUG |
valine |
GCG |
alanine |
GAG |
glutamate |
GGG |
glycine |
Homework Answers
Translation- The process of polymerisation of amino
acids to form polypeptide. The sequence of amino acids are given
below
Add Answer to:
Translation: find the start codon AUG on the mRNA below,
underline nucleotides in sets of three...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
i think it might be Glutamate, but im not sure. Someone please help!! its the last...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The...
options
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
options
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
Most questions answered within 3 hours.
-
Determine the pH of a 0.10 M
CH3NH3Cl solution.
(Kb
(CH3NH2) = 4.4 x 10-4)
2.18...
asked 4 minutes ago -
Asolid metal sphere with radius 0.470 m carries a net charge of
0.200 nC .
Part...
asked 27 seconds ago -
Determine the pH of a 0.0500 M KBr solution (using activity
coefficients when needed)
( please...
asked 1 minute ago -
Bender's skateboards have the following manufacturing
expenses:
Direct Materials: $10/unit
Direct Labor: $8/unit
Rent: $10,000/month
Depreciation:...
asked 10 minutes ago -
9) A resistor is connected to a capacitor of 4 micro-farads
without a battery. The initial...
asked 19 minutes ago -
Via Gelato is a popular neighborhood gelato shop. The company
has provided the following cost formulas...
asked 39 minutes ago -
The Williams have a stock they have held for over a year that
they believe is...
asked 1 hour ago -
11.53g sample of NaBr contains 22.34% Na by mass Considering
the law of constant composition how...
asked 2 hours ago -
Exercise 5-22A Complete the accounting cycle using receivable
transactions (LO5–1, 5–2, 5–4, 5–5, 5–7) [The following...
asked 3 hours ago -
Do you agree with the view that small businesses are more
vulnerable to employee theft because...
asked 3 hours ago -
Four forces act on an object, given by A = 41.3 N east, B = 46.3...
asked 4 hours ago -
Which of the following design considerations leads to more
user-friendly presentation layers for GUIs? [Check all...
asked 5 hours ago