Question

you wish to switch two hot so that the power is either off or provided to...

you wish to switch two hot so that the power is either off or provided to either one or two loads. to do this, you should use a/an ----- switch. a. dpst b. spdt c. dptt d. dpdt

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANS - (D) DPDT

Explanation:

DPST refers to Double Pole Double Throw. A Double Pole Double Throw (DPDT) switch is a switch that has 2 inputs and 4 outputs; each input has 2 corresponding outputs that it can connect to.

main-qimg-04506d3385715b44482c58df16bbe2

Double Pole Double Throw (DPDT) 3wtch Input Terminale output Terminals

Each of the terminals of a double pole double switch can either be in 1 of 2 positions. This makes the the double pole double throw switch a very versatile switch. With 2 inputs, it can connect to 4 different outputs. It can reroute a circuit into 2 different modes of operation.

Below is an example of a circuit which utilizes a double pole double throw switch

lamp 白白-- paaker

You can see above how a double pole double throw switch can allow a circuit to be in 1 of 2 modes. When the DPDT switch is switched one way (flipped upward in the diagram), the lamp and buzzer are both on, while the LED and speaker are off. When the DPDT switch is switched the other way (flipped downward), the LED and the speaker are both on, while the lamp and buzzer are off.

This shows the dynamic 2-mode capacity that DPDT switches allow, allowing control of 4 different devices (with 2 operational modes).

Add a comment
Know the answer?
Add Answer to:
you wish to switch two hot so that the power is either off or provided to...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Upon power up, LEDI flashes 10 times and then turns off. Use either a FOR or a WHILE loop. (5 poi...

    Upon power up, LEDI flashes 10 times and then turns off. Use either a FOR or a WHILE loop. (5 points) 4. Power 013 D12 Arduino D" - D1O 07 06 DS 04 A3 02 D1 Upon power up, LEDI flashes 10 times and then turns off. Use either a FOR or a WHILE loop. (5 points) 4. Power 013 D12 Arduino D" - D1O 07 06 DS 04 A3 02 D1

  • You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:...

    You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1: Primer 1: CTATGAAACAAGAATCGACC Primer 2: GTGCCGTAAAGCACTAAATC a. What secondary structure is formed by each primer at 54°C? b. What secondary structure is formed by both primers together at 54°C? c. If we were to use the following PCR protocol with primer 1 and primer 2, what would we expect to see on the electrophoresis gel? Step Time Temperature Initiation 2’ 95°C Denaturation 1’ 95°C...

  • e. 95% of 100 QUESTIONS Switch Selection turn on and turn off control Power dextronics Circuit...

    e. 95% of 100 QUESTIONS Switch Selection turn on and turn off control Power dextronics Circuit function by using semiconductor devices as watches, thereby controlling or modifying a voltage or current When these devices (eg diodes, thystors, transtors, etc) are Operated as a match they are characterized by having the two Bateson and deally being ther a short circuitor an open Circuit One basic d ance between the power electronic uching dences is how they are tumed on and off,...

  • 0 4800 8000 15. Given that you wish to use the payback rule with a cut-off...

    0 4800 8000 15. Given that you wish to use the payback rule with a cut-off period of two years, which projects in Table 1 would you accept? a. Project X b. Project Y. c. Project Z. d. None of the above. 16. Which of the following statements is true regarding the payback rule? The payback rule states that a project should be accepted if its payback period is more than a specified cutoff period. The payback rule emphasizes cash...

  • Balloons By Sunset (BBS) is considering the purchase of two new hot air balloons so that...

    Balloons By Sunset (BBS) is considering the purchase of two new hot air balloons so that it can expand its desert sunset tours. Various information about the proposed investment follows:   Balloons By Sunset (BBS) is considering the purchase of two new hot air balloons so that it can expand its desert sunset tours. Various information about the proposed investment follows: Initial investment (for two hot air balloons) Useful life Salvage value Annual net income generated BBS's cost of capital $...

  • 5. A three-way lamp has four switch positions: off, low, medium, and high brightness settings when...

    5. A three-way lamp has four switch positions: off, low, medium, and high brightness settings when used with a working three-way light bulb. Such a bulb has only two filaments; when connected to 120-V household circuit one filament dissipates 60W of power while the other filament dissipates 120W. (a) Calculate the resistances of the two separate filaments. b) Explain how current must flow through the bulb to dissipate 180W at the fourth switch position. c) The most common way for...

  • Lacking rock salt, I turn to hot water to get the ice off my porch. So...

    Lacking rock salt, I turn to hot water to get the ice off my porch. So I bring water to a boil in my tea kettle and pour it on the ice.   How much boiling water do I need melt a thin 1.5 kg sheet of ice? You may assume the ice is already at 0°C and that none of the boiling water re-freezes (which is why it’s a rather poor idea in reality).  

  • Balloons By Sunset (BBS) is considering the purchase of two new hot air balloons so that...

    Balloons By Sunset (BBS) is considering the purchase of two new hot air balloons so that it can expand its desert sunset tours. Various information about the proposed investment follows:   Initial investment (for two hot air balloons) $ 455,000 Useful life 8 years Salvage value $ 55,000 Annual net income generated 40,040 BBS’s cost of capital 11 % Assume straight line depreciation method is used.    Required: Help BBS evaluate this project by calculating each of the following:   1. Accounting...

  • Imagine you are comparing the ability of electric hot plates of different sizes and temperatures to...

    Imagine you are comparing the ability of electric hot plates of different sizes and temperatures to fully cook two identical large pots of spaghetti. Note that all the pots are as large as the largest hot plate. The color of each hot plate is used to illustrate its i emperature. 21 If you use two hot plates of the same size, can you assume that the hot plato tmat can cook a large pot of spaghetti first is at the...

  • Balloons By Sunset (BBS) is considering the purchase of two new hot air baloons so thar...

    Balloons By Sunset (BBS) is considering the purchase of two new hot air baloons so thar t can expand its desert sunset tours. Vanous information about the proposed investment follows: Initial investment (or two hot air balloons) 442,000 Sahrage value Annual net income genarated BBSs cost of capial S 55,000 5,360 10% Assume straight Ine depreciation method is used Required: Hep E6s evaluate this project by calculating each of the following: 1. Accounting rate of retum (Round your answer to...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT