Outline a synthesis of the tripeptide Gly-Val-His. Use appropriate protecting groups in your sequence. You may...
Protecting Groups in Organic Synthesis 15) Propose how you could carry out the following synthetic sequence. Hint: PBrs converts alcohols to bromides Br OH он 16) A student tried to carry out the reaction sequence below, but none of the diol (A) was formed. Explain what went wrong with the plan and design a successful synthesis of A. OH он 2. H3O+
Problem II. Synthesis (16 points). Outline a synthesis-i.e, a sequence of reactions-to prepare compound H using compound G as the starting material. You may use any other reagents and starting materials you wish.
STRUCTURE WILL VARY DEPENDING IF PKA IS LARGE OR SMALL, Draw a formula for Val-Ser-Gly (V-S-G) in its predominant ionic form at pH 7.3. You may assume for the purposes of this question that the pKa values of the acidic groups of amino acid residues in the peptide are the same as in the amino acid itself. You do not have to consider stereochemistry. You do not have to explicitly draw H atoms. Do not include lone pairs in your...
If you sketch the titration curve for the following protein (Ser−Tyr−Ser−Met−Glu−His−Phe−Arg−Trp−Gly−Lys−Pro−Val), near what pH values would you expect the curve to exhibit inflections? Assume the pKas of the N- and C-termini are 7.9 and 3.8, respectively. For side chains, assume the pKa values given. The curve will exhibit infections corresponding to ___ group(s) titrating near 4 (____), ___ group(s) near 6.5 (____), ____ group(s) near 8 (____), ___ group(s) near 10 (____) and ___ group(s) near 12 (___). Match the...
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
10% Multi Step Reactions 6) Show how you would accomplish the following synthesis in good yields. You may use any reagents that you wish. Hint: Protect 2 different functional groups if you choose to use a Grignard's reagent. :OH : OH но 10% Multi Step Reactions 6) Show how you would accomplish the following synthesis in good yields. You may use any reagents that you wish. Hint: Protect 2 different functional groups if you choose to use a Grignard's reagent....
b) Show how you would accomplish this synthesis. You may use any reactants/reagents. thermo Only your final answer should be drawn inside this box c) Show how you would accomplish this synthesis. You may use any reactants/reagents. Only your final answer should be drawn inside this box
2) Propose a synthesis for the transformation below. You may use any reagent discussed in the course notes or textbook, as well as any additional compound with 2 or fewer C atoms in your solution. (5 marks)
2) Propose a synthesis for the transformation below. You may use any reagent discussed in the course notes or textbook, as well as any additional compound with 2 or fewer C atoms in your solution. (5 marks) هر
2. The structure of the solid phase Wang resin linker and the first amino acid that we will use in this lab is shown below Fmoc first amino acid linker a) (1 pt) If the resin has 0.72 mmol/g of this linker on the surface of the beads, and you use 300 mg of resin for the reaction, how many mmol of linker do you have? b) (3 pts) All peptides will use alanine at the C-tenminus (position 1), Fmoc-L-valine...