Question

Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide...

Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide sequence of the DNA determined. There are many different techniques for this. In lab, you isolated and amplified DNA from a known organism (Escherichia coli), but what if you had to identify an unknown organism? You would send the sample away for sequencing and then once you got the results you would “BLAST” the sequence.

Using the Standard Nucleotide BLAST on NCBI and the sequences listed on the next page, identify the most likely genus and species of the unknown 4 bacterias whose sequences are listed. BLAST is quite user-friendly – simply copy the sequence of interest (omit the “Ns” at the beginning and end of each sequence), and paste the sequence into the large box at the top of the website, and click on the “BLAST” button at the bottom. Then choose the name of the organism at the top of your list. “BLAST” stands for “Basic Local Alignment Search Tool.

unknown 1

NNNNNNNNNNNNNNNNTCTGTCGCTACGTCAAATGATAGTGCTATTAACACTACCACCTTCCTCACGACTGAAAGTGCTTTACAACCCGAAGGCCTTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGATCATCCTCTCAGACCAGCTAGGGATCGTCGCCTTGGTGAGCCCTTACCTCACCAACTAGCTAATCCCACCTGGGCATATCCTGACGCGAGAGGCCCGAAGGTCCCCCTCTTTGAGCCGAAGCTATCATGCGGTATTAGCCATCGTTTCCAATGGTTATCCCCCACATCAGGGCAATTTCCCAGGCATTACTCACCCGTCCGCCGCTCGCCACCCGAGAAACAAGTTTCTCTGTGCTGCCGCTCGACTTGCATGTGTTAGGCCTGCCGCCAGCGTTCAATCTGAGCCANNNNCNAAACTNNNNN

unknown 2

NNNNNNNNNNNNNNNNNNTNNNNNNNNNANTACGTCACAGTCAGCAGATATTAGCTACTGACCTTTCCTCCTCGCTGAAAGTGCTTTACAACCCGAAGGCCTTCTTCACACACGCGGCATGGCTGCATCAGGGTTTCCCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGATCATCCTCTCAGACCAGCTAGGGATCGTCGCCTTGGTGAGCCATTACCTCACCAACTAGCTAATCCCACCTGGGCATATCCAATCGCGCAAGGCCCGAAGGTCCCCTGCTTTCCCCCGTAGGGCGTATGCGGTATTAGCAGTCGTTTCCAACTGTTATCCCCCTCGACTGGGCAATTTCCCAGGCATTACTCACCCGTCCGCCGCTCGCCGGCAAAAGTAGCAAGCTACTTTCCCGCTGCCGCTCGACTTGCATGTGTTAGGCCTGCCGCCAGCGTTCAATCTGAGCCATGATCAAACTNNNN

unknown 3

NNNNNNNNNNNNNNNNNNNNAAAAGGNNNCCCCGATACCGTCAGGGATGAAGTTTCATTTTACTCTCATCCTTGTTCTTCTCTAACAACAGAGTTTTACGATCCGAAAACCTTCTTCACGCCTAGTTGCTCGGTCAGACTTTCGTCCATTGCCGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGAGTCCCTAGCAGTGTGGCCGATCACTCAGGTCTTTTGGCTATGCATCGTTGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCAGACGCAAAAGCGCCTTTCAACTTTCTTCCATGCGGAAAATTTATACGGTATTAGCACCTCCAAGTGTTATCCCCTTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTCTTTTTCTTTCCTAGGGTGGAGCAAGCTCCGGTGAAAGAAAAAGCGTTCGAAAAACTTGCATGTATTAGGCACG GCCAGCGTTCGTCCTGAGCCATGATCTTCTCNNNN

unknown 4

NNNNNNNNNNNNNNNNACCTCGTCGCTACGTCAAATGATAGTGCTATTAACACTACCACCTTCCTCACGACTGAAAGTGCTTTACAACTCCGAAGGCCTTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCTTACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTTCAGTTCCAGTGTGGCTGATCATCCTCTCAGCCAGCTAGGGATCGTCGCCTTGGTGAGCCCTTACCTCACCAACTAGCTAATCCCACCTGGGCATATCCTGACGCGAGAGGCCCGAAGGTCCCCCTCTTTGAGCCGAAGCTATCATGCGGTAATTAGCCATCGTTTCCAATGGTTATCCCACATCAGGGCAATTCCCAGGCATTACTCACCCGTCCGCCGCTCGCCACCCGAGAACAAGTTTCTCTGTGCTGCCGCTCGACTTGCATGTGAGGCCTGCCGCCAGCGTTCAATCTGAGCCANNNNCNAAACTNNNNN

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The BLASTn tool is used to find out the identity of unknown nucleotide sequences.
Unknown 1 = Vibrio vulnificus
Unknown 2 = Aeromonas hydrophila
Unknown 3 = Enterococcus casseliflavus
Unknown 4 = Vibrio vulnificus

Add a comment
Know the answer?
Add Answer to:
Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam!...

    Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam! Great!” she thought. It was always nice to get a call from her older brother. But a little twinge of worry tugged at her. It was just a couple of weeks ago that he had mentioned making an appointment with his doctor about some abdominal pain he had been having. “Hi Sam! It’s great to hear from you,” Jane answered. “Hi Jane. Well I...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT