Hello. i am very stumped on this question. i was wondering if you can help! thank you so much
Answer:-
Given That:-
Customer ages An analyst at a local bank wonders if the age distribution of customers coming for service at his branch in town is the same as at the branch located near the mall.
a) Whatis the null hypothesis?
Null hypothesis: The age distribution of customers in the town is the same as the age distribution of customers in the mall.
b) What type of test is this?
The Chi-square test of Independence
c) What are the expected numbers for each cell if the null hypothesis is true?
The expected numbers of each cell are got as follows:
Less than 30 | 30 - 55 | 56 or order | Total | |
In-Town branch | 50 * 100 /200 = 25 | 90* 100/200 = 45 | 60 * 100/200 = 30 | 100 |
Mall branch | 50*100/200 = 25 | 90* 100/200 = 45 | 60 * 100/200 = 30 | 100 |
Total | 50 | 90 | 60 | 200 |
d) Find the statistic?
The statistic is got as follows:
Observed (O) | Expected (E) | |
20 | 25 | 1.00 |
40 | 45 | 0.56 |
40 | 30 | 3.33 |
30 | 25 | 1.00 |
50 | 45 | 0.56 |
20 | 30 | 3.33 |
Total = = | 9.78 |
e) How many degrees of freedom does it have?
Degrees of freedom = (r - 1) x (c - 1)
= (2 - 1) x (3 - 1)
= 2
f) Find the p -value
By Technology p -value = 0.00753
g) What do you conclude?
Since p - value is less than difference is significant.
Reject null Hypothesis.
Conslusion:
The data do not support the claim that the age distribution of customers in the town is the same as the age distribution of customers in the mall.
Thank you for your supporting. Please upvote my answer...
Hello. i am very stumped on this question. i was wondering if you can help! thank...
An analyst at a local bank wonders if the age distribution of customers coming for service at his branch in town is the same as at the branch located near the mall. He selects 100 transactions at random from each branch and researches the age information for the associated customer. Here are the data: Less than 30 30 - 35 56 and older Total In-Town Branch 20 40 40 100 Mall Branch 30 50 20 100 Total 50 90 60...
17)An analyst at a local bank wonders if the age distribution of customers coming for service at his branch in town is the same as at the branch located near the mall. He selects 100 transactions at random from each branch and researches the age information for the associated customer. Here are the data: 17) An analyst at a local bank wonders if the age distribution of customers coming for service at his branch in town is the same as...
I am wondering if you can help me out with these questions. I am very confused. 1. A math teacher gave her class two tests. While 70% of the class passed the first test and 75% of the class passed the second test, only 65% of the class passed both. Given that the students failed the first test, what probability of those will passed the second test? 2. In the game of roulette, a player can place a $5 bet...
Hello I was wondering If i can get some help with a question I am stuck on or more so a concept. Formula: z = (x-μ)/(σ ) Σ = 1.1 lbs. Μ = 4.1 lbs. Z = (7 – 4.1) / 1.1 = 2.6 =.9953 This is what I get when I input my number in a normal distribution solver online= 0.0047 My issue is when calculating the Z number it seems like it will sometimes be negative and sometimes...
Hello everyone! I was wondering if someone can help me write the the equation for this reaction, am I supposed to include the M in the equation for this? "Dissolve a small amount of Na2SO4 in 2 mL of deionized water. then add 20 drops of 6M HCl and no more than 4-6 drops of 0.1 M BaCl2 solution and write the balanced net ionic equation for this reaction"
hello i was wondering if you could help me answer this question “draw the structure of a dipeptide compund of one polar and one non-polar amino acid. Draw an arrow pointing to the peptide bond. Label N- and C- termini.”
Hello, I was wondering if you would answer the following questions for me. Thank you! QUESTION 3 How many 2-member committees can be formed from a group of 7 people? O 21 00 42 0 1 QUESTION 4 In how many different ways can 8 books be arranged on a shelf? 40320 O 1 O 8 O 56
Hello, I am having issues with this question. Please do show work, Thank you very much! Strategic Initiatives and CSR Get Hitched Inc. is a production company that is in the process of testing a strategic initiative aimed at increasing gross profit. The company's current sales revenue is $1,500,000. Currently, the company's gross profit is 35% of sales, but the company's target gross profit percentage is 40%. The company's current monthly cost of production is $975,000. Of this cost, 50%...
Hello, I was wondering if you could help me with my payroll question? 1. How does the employer’s choice of payroll cycle impact earnings calculations?
Hello! I am working on this genetics problem and was wondering if you could check my letter d. I am not sure if this mRNA sequence is correct and would really appreciate the help. Thank you! 4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...