Hello! I am working on this genetics problem and was wondering if you could check my letter d. I am not sure if this mRNA sequence is correct and would really appreciate the help. Thank you!
Since the bottom strand is the template the mRNA synthesized would be similar to the coding strand and complementary to the template strand. So just write the sequence of coding strand by replacing T with U get the mRNA sequence.
Keep one thing in mind that RNA does not contain thymine.
5'AGGGGUUCCUUCGUCGAUCGC 3'
Hello! I am working on this genetics problem and was wondering if you could check my...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T A C A C C G G T C A G G T G A T C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...
1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...
Hello! I am working on this genetics problem and was wondering if these two answers would make sense. Thank you for the help! Question 1 (1 point) Saved Why can bacteria have poly-cistronic genes? Because they need multiple cistron organelles so they segregate evenly during cell division. Because they have many exons that are joined together before translation Because ribosomes can be loaded at multiple Shine Delgano/AUG sequences. Because ribosomes are loaded at the single CAP site. Because the stability...