Question

base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that win
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer

40) A) helicase

Explanation : helicase breaks the hydrogen bond present between the two strands of the DNA during replication and thus helps in unwinding of the DNA

41) C)

Explanation : synthesis of leading strand is continuous whereas that of lagging strand is discontinuous in the form of segment call Okazaki fragments

42) C) Leu - lys- Cys - Phe

43)A)GAG-UUC - ACG-AAG

44) D) stop codons

Explanation : these Codons are responsible for termination of translation and they do not code for any amino acids

45) D) tRNA

46) D)

Add a comment
Know the answer?
Add Answer to:
base pairing Done stand is positively charged and th one strand contains only purind e DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • 7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...

    7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT