Homework Answers
DNA 3' AATTACCGGACAGGCGCA
CGATCA GGCGATATGACGTACCCAGGGTACTGAAGGGGT 5'
MRNA 5' UUAAUGGCCUGUCCGCGUCCGCUAUACUGCAUGGGUCCCAUGACUUCCCCA 3'
5' UUA AUG GCC
UGU CCG CGU CCG CUA UAC UGC AUG GGU CCC AUG ACU UCC CCA 3'
PROTEIN
Met-Ala-Cys-Pro-Arg-Pro-Leu-Tyr-Cys-Met-Gly-Pro-Met-Thr-Ser-Pro-
Add Answer to:
you are informed that CGATCA codes for an intron
UUU)phe UCU UAU TVE UUC) Pne UCC...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
The following genomic DNA sequence comes from the first exon of a human gene and contains...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
Most questions answered within 3 hours.
-
A χ2-curve, looking at the relationship between age and hours
spent working at an office per...
asked 30 seconds from now -
The pH of a sample of water from a river is 5.0. A
sample of effluent from...
asked 44 minutes ago -
At the beginning of the period, the Fabricating Department
budgeted direct labor of $136,500 and equipment...
asked 1 hour ago -
Please answer all
____ 28. Rent control is usually
justified on the grounds that it protects...
asked 1 hour ago -
PARTS A-D HAVE BEEN ANSWERED. WAS TOLD TO REPOST. ONLY ANSWER
PARTS E and F.
A...
asked 1 hour ago -
2) You are given the task of finding a representation for a
circle in a drawing...
asked 2 hours ago -
STUDY QUESTION: Does use of diet drug fen-phen
(fenfluramine-phentermine) cause valvular heart disease?
HINT: Valvular heart...
asked 2 hours ago -
1. An object weighing 40 N rests on a surface. The coefficient
of friction is 0.35....
asked 3 hours ago -
Investor company owns 35% of investee company voting stock and
accounts for the investment under the...
asked 4 hours ago -
The number of major faults on a randomly chosen 1 km stretch of
highway has a...
asked 5 hours ago -
Consider the competitive environment of Starbuck's, Progressive
Insurance, a manufacturing firm with low turnover, or a...
asked 6 hours ago -
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 7 hours ago