10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...