Question

The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

b). Leu- Cys-Cys-His-Asp

Explanation:

First write the DNA in reverse order as template (3’ – 5’).

DNA:     3’– GATACAACGGTACTG -5’

mRNA: 5’ –CUAUGUUGCCAUGAC – 3’

Peptide:       Leu- Cys-Cys-His-Asp

I

Add a comment
Know the answer?
Add Answer to:
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

    Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

  • . Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following da...

    . Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15

  • Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-

    Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT