please explain how to solve this problem, the answer is provided
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...
please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This peptide yields the following results when broken down into smaller fragments Please note the AA are given in alphabetical order). Show your work, explain your reasoning, give the answer in three letter abbreviation and one letter abbreviation Fragment Content His Treatment Edman Chymotrypsin Gly. His, Phe Ser, Tyr Arg2, Leu, Lys, Ser.Ala, Phe Trp, Val Gly, His, Lys,...