Question

Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU GUC GUA GUG GCU) GCC GCA GGU GGC GGA Val GAU? GACJ GAA GAG) Ala GCG) GGG) You are given a piece of nucleic acid that has the following sequence and told that it is part of the chromosome of an organism. In addition you are informed that CGATCA codes for an intron 3:- AATTACCGGACAGGCGCACGATCAGGCGATATGACGTACCCAGGG TAC TGAAGGGGT-5' 1. Assuming the protein synthesis machinery of the organism functions correctly, give the sequence of the protein that would be synthesized from the DNA 2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 2) 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution or frameshift mutation. Answer is one of the following: Silent, Missense or Nonsense mutation)

Answer 1

Anse civene Given CGATCA Codon for an intron . It is a non functional part of RNA which is spliced and then m-RNAIL formed for the protin synthesis. - Given DNA sequence AATTACCGGACAGGCGCACGATCA GGCGATATGAC GIACCCAGGGTALTGAAGGG GI-5 from DNA at first hoRNA i formed S-UUAAUGGCCUGUCCGCGUGGUAGUCCGCUAUACU GCAUGGGUCCC AUG ACUUCCCCA-3 After formin hn RNA we have cap this methy) guanon- sine and 200 nucleotide of adenylic acid are added to its slend which is called poly 'A' tail now its stable by the process of a RNAsplicing hn RNA produces functional m-RNA ( No intron there). Aus I final mRNA for protein synthesis is S-UUA AUGG CC UGUCCGCGU CCM CUA ACUGC AUG GGUCCC AUGACU ACU UCC CCA-31 Here AUG stands for start codon & VAA, UAG & UG A Stands for stopcodem Sequence of protein Met - Ala-Cys-Pro-Arg -Pro-Leu-Tyr-Cys- Met Gly-Pro-Met-The-ser-Pro.

Ans@ If a mutation occurs and alters the sequence CGAIATGA 1o CGALAICA effed shown below. Then DNA look like here we remove intron part we show why we splice the intron part in answer From the Question S3-AATAcc co, ACA Choctnсе аса с АТАГСА СcnTA CCCAGGGTACTGAAGGGGT-5 m. RNA look like a 5-DQA ALEGCCU GUCCGCGUCCG CUA UAG UGCAU GGGUCCCANGGG UCCE AUGACUUCCCCA-3 Pootein from the codon Met-Ala-Cys-Pro-Arg - Pro-Lou-Stop - - Gly. Pro-met - Thraser-Pro. - met final effect of the protein made is it is horder than the original due to stop codon and after that agap for UGC then met start codon) comes it form protein normally nonno Aus the sequence of the protein that would result from such a mutation Met-Ala-cys-Pro-Ang-Pro-Leu-stop Cly-pro-met- Thraser-Doo. -met Aw @ It is Nonsense mutatim