Question

2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU_CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant RNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO.) U U Phe Phe Leu Leu CLeu Leu Leu Leu Alle lle lle Met GVal Val Val Val с Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala А G Tyr Cys U Tyr Cys с STOP STOP A STOP Trp G His Arg U His Arg с Gin Arg А Gin Arg G Asn Ser U Asn Ser с Lys Arg А Lys Arg G Asp Gly U Asp Gly с Glu A Glu Gly G b. If not, how does it differ? c. How many different version of the short polypeptide will exist in this mutant cell? Gly

Answer 1

Answers for 1st and 2nd question is attached below:

4)a)No,the protein will not match.

     b)It may have two valines side by side at 5th and 6th position respectively.

5)Two versions.

One is normal protein what we got in 2nd question,other having Valine at 5th and 6th position.