1. How do UPGMA and NJ similar? 2. How does the BLAST algorithm work? What is...
1. How do UPGMA and NJ similar?
2. How does the BLAST algorithm work? What is a ‘word’? How are words derived from the input (query) sequence? Once words are identified from the input, what is searched? How does BLAST extend a match?
3. How do BLOSUM and PAM compare? What’s similar between the two? What’s different? How do sequence search algorithms (e.g., BLAST) and transition matrices (e.g., BLOSUM and PAM) relate?
Homework Answers
1) UPGMA is expanded as Unweighted paired group method with arithmetic mean while NJ can be expanded as Neighbor Joining. Both these methods are used to construct phylogenetic trees.
These both methods are based on the distance between taxa for constructing the phylogenetic trees,
UPGMA will look for the least distant taxa and group it together while NJ will look for the distant of pair taxa from the node and also outside the node, then the algorithm will make the tree.
Add Answer to:
1. How do UPGMA and NJ similar?
2. How does the BLAST algorithm work? What is...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
ing questions. a. What does BLAST do and how is it useful for your experiment? b....
ing questions. a. What does BLAST do and how is it useful for your experiment? b. How does BLAST calculate the maximum score? c. How does BLAST calculate the query coverage? d. How does BLAST calculate the E-value?
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow...
1. According to the paper, what does lactate dehydrogenase
(LDH) do and what does it allow to happen within the myofiber? (5
points)
2. According to the paper, what is the major disadvantage of
relying on glycolysis during high-intensity exercise? (5
points)
3. Using Figure 1 in the paper, briefly describe the different
sources of ATP production at 50% versus 90% AND explain whether you
believe this depiction of ATP production applies to a Type IIX
myofiber in a human....
What an Executive Summary Is An executive summary is a specific type of document that does...
What an Executive Summary Is
An executive summary is a specific type of document that does
two things: it summarizes a research article, and it offers
recommendations as to how information from the article can be
used.
Some long reports can contain an executive summary section, as
indicated in the Pearson handbook.
Write a 2 pahe Executive Summary
In business contexts, an executive summary is always written
for a specific purpose: to explain the information in the article
to a...
Required: 1. What is the amount of Apple’s accounts receivable as of September 30, 2017? 2....
Required:
1. What is the amount of Apple’s accounts
receivable as of September 30, 2017?
2. Compute Apple’s accounts receivable turnover as
of September 30, 2017.
3. How long does it take, on average, for
the company to collect receivables for fiscal year ended September
30, 2017?
4. Apple’s most liquid assets include (a)
cash and cash equivalents, (b) short-term marketable
securities, (c) accounts receivable, and (d)
inventory. Compute the percentage that these liquid assets (in
total) make up of...
Discussion questions 1. What is the link between internal marketing and service quality in the ai...
Discussion questions
1. What is the link between internal marketing and service
quality in the airline industry?
2. What internal marketing programmes could British Airways
put into place to avoid further internal unrest? What potential is
there to extend auch programmes to external partners?
3. What challenges may BA face in implementing an internal
marketing programme to deliver value to its customers?
(1981)ǐn the context ofbank marketing ths theme has bon pururd by other, nashri oriented towards the identification of...
ing questions. a. What does BLAST do and how is it useful for your experiment? b. How does BLAST calculate the maximum score? c. How does BLAST calculate the query coverage? d. How does BLAST calculate the E-value?
1. According to the paper, what does lactate dehydrogenase
(LDH) do and what does it allow to happen within the myofiber? (5
points)
2. According to the paper, what is the major disadvantage of
relying on glycolysis during high-intensity exercise? (5
points)
3. Using Figure 1 in the paper, briefly describe the different
sources of ATP production at 50% versus 90% AND explain whether you
believe this depiction of ATP production applies to a Type IIX
myofiber in a human....
What an Executive Summary Is
An executive summary is a specific type of document that does
two things: it summarizes a research article, and it offers
recommendations as to how information from the article can be
used.
Some long reports can contain an executive summary section, as
indicated in the Pearson handbook.
Write a 2 pahe Executive Summary
In business contexts, an executive summary is always written
for a specific purpose: to explain the information in the article
to a...
Required:
1. What is the amount of Apple’s accounts
receivable as of September 30, 2017?
2. Compute Apple’s accounts receivable turnover as
of September 30, 2017.
3. How long does it take, on average, for
the company to collect receivables for fiscal year ended September
30, 2017?
4. Apple’s most liquid assets include (a)
cash and cash equivalents, (b) short-term marketable
securities, (c) accounts receivable, and (d)
inventory. Compute the percentage that these liquid assets (in
total) make up of...
Discussion questions
1. What is the link between internal marketing and service
quality in the airline industry?
2. What internal marketing programmes could British Airways
put into place to avoid further internal unrest? What potential is
there to extend auch programmes to external partners?
3. What challenges may BA face in implementing an internal
marketing programme to deliver value to its customers?
(1981)ǐn the context ofbank marketing ths theme has bon pururd by other, nashri oriented towards the identification of...
Most questions answered within 3 hours.
-
The factory method and the abstract factory pattern use
different object oriented
mechanisms are used to...
asked 1 hour ago -
Given the data below for the monthly sales data at each branch in
your region for...
asked 1 hour ago -
Blossom Company owns 10000 of the 50000 outstanding shares of
Taylor, Inc. common stock. During 2018,...
asked 3 hours ago -
Calculate the following: ***SHOW ALL WORK!!!! Or
NO CREDIT*** Circle your answers. 8pts
each
In the...
asked 4 hours ago -
Bank Z is currently advertising interest rates on its checking
account. They claim to pay an...
asked 4 hours ago -
List two ways of transformation on the response variable that
can be used to deal with...
asked 5 hours ago -
If a 2000 ohm resistor has a -3.90 mA current going through it.
What is the...
asked 5 hours ago -
Please comment on the sentences.
Some types of jobs require more training than others. Some
companies...
asked 6 hours ago -
The )G01 for the hydrolysis of phosphorarginine
reaction depicted below is –32 kJ mol-1.
Phosphoarginine ...
asked 7 hours ago -
Cross a heterozygous blue-eyed goat with a homozygous brown-eyed
goat. Be sure to indicate which kids...
asked 7 hours ago -
Use the following information to answer the next two
questions.
Please refer to question 9-90. A...
asked 7 hours ago -
A solution containing 0.050 g of an unknown electrolyte in 2.50
g of cyclohexane was found...
asked 7 hours ago