Question

1. The figure below shows a DNA double helix and its nucleotide sequence.

A. A homodimeric helix–turn–helix protein binds to a DNA fragment containing this sequence. Its preferred half-site is AACAC. Show where the two recognition helices in the protein contact the DNA.

B. Are protein–DNA contacts primarily in the major or the minor groove of DNA? What parts of the nucleotides contact the amino acid side chains of the protein to provide most sequence specificity? What kind of bond is primarily responsible for specific protein–DNA interactions?

C. If 5 base pairs are inserted in the middle of a binding site for a dimeric helix–turn–helix protein, binding is abolished. If 10 base pairs are inserted, binding is sometimes preserved, albeit with lowered affinity. Explain these observations.

CGCATAAAATAACACCGTGCGTGTTGTA GCGTATTTATTGTGGGCACGCACAACAT

Answer 1

A. The two recognition helices in the protein contact the DNA at CA.

B. Protein-DNA contacts primarily one in the major groove and one in the minor groove of DNA. A hydrogen- bonding complementary between the bases that contact the DNA at the Alfa-helical region and amino acid side chains of protein provides the correct matching.

C.If the bases are mismatched then the helix-turn-helix protein binding is abolished, but if the bases pairs match the nucleotide base pairing then the helix is preserved.