Hello! I was wondering if you could explain why in both of these cases, the OH...
Homework Answers
ioAdd Answer to:
Hello! I was wondering if you could explain why in both of these
cases, the OH...
hello i was wondering if you could help me answer this question “draw the structure of...
hello i was wondering if you could help me answer this question “draw the structure of a dipeptide compund of one polar and one non-polar amino acid. Draw an arrow pointing to the peptide bond. Label N- and C- termini.”
Hello, I was wondering if you could check my answers 27. Within wi:1.PBLSteatorn withthe Small stttomic...
Hello, I was wondering if you could check my answers
27. Within wi:1.PBLSteatorn withthe Small stttomic radius a) Bi c) As 2nd is Sma lles S mall 28. Within Group 14, which of the following is the, most metallic elemen b Si Ge 29. Which of the following has an ionic radius that is smaller than its atomic radius? a) neon Nc nitrogen c) sodiuma sulfur 30. Which of the following molecules does not have a polar covalent bond? a)...
HiI was wondering if I could get help on solving this? I'm very stuck on this...
HiI was wondering if I could get help on solving this? I'm very
stuck on this question. Thank you!
Below is an image of a nucleic acid. Identify the pieces of nucleic acid. 0-P=O 0-2-0-0 LI Base to-2 HD -0-P=0 A. A, T, G, C, or U 3' Carbon with a phosphodiester bond to the next nucleotide in sequence C. In a molecule of RNA, the 2' hydroxyl would be here. D.5' Phosphate E. Ribose Sugar F. 5' Carbon G....
Hello! I am working on this genetics problem and was wondering if you could check my...
Hello! I am working on this genetics problem and was wondering
if you could check my letter d. I am not sure if this mRNA sequence
is correct and would really appreciate the help. Thank you!
4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...
please explain in detail. thank you in advance . Consider the regioselectivity observed in these E2 reactions. Note...
please explain in detail. thank you in advance .
Consider the regioselectivity observed in these E2 reactions. Note that product A forms when the base (methoxide ion, CH,0) removes the proton from the carbon labeled B., while product B forms when the base removes the proton from the carbon labeled B2. Why is formation of the less highly substituted (less stable) double bond favored in product B? (1 pt) CHE B CHE A -- Reaction #1 CH, O product A...
Could you help me understand these please? I am struggling to answer these. Which of the...
Could you help me understand these please? I am struggling to
answer these.
Which of the following set of reagents would be the best choice to complete the following Suzuki-Miyaura reaction? Вона 2 cul Pd(OAC)2 но" 1. Tsci 2. PBI 1. Mg 2. CH,OH Pd(PPhala NaOE Oc Od O e ob Оа What is the most likely (major) product for the following reaction given a 1:1 ratio of reagents? HOJ - - BI - - O Tonly O III Only...
Hello! :) Could someone please assist me? Thank you in advance. I appreciate you. Q: What...
Hello! :) Could someone please assist me? Thank you in advance. I
appreciate you.
Q: What is the major product formed in each reaction?
13. What is the major product formed in each of the following reactions. CH,CH2CHCH3 + H2O DON BHs H2O2 (CH3)2 CH CH CH HO CH,CH=CH2 + HBr - CECH HgSO4 H20/H2SO4 x H2SO4 H2SO4 ethanol B & NOCH + NaOCH3 OH Na2Cr2O7 H2SO4 CH3NH2 + HBr HE OCH.CH
Hello, I am not sure what I am doing wrong. Could someone please explain :) Thank...
Hello, I am not sure what I am doing wrong.
Could someone please explain :)
Thank you!
The mineral dolomite contains magnesium carbonate. This reacts with hydrochloric acid. MgCO3(s) + 2 HCl(aq) + CO2(g) + MgCl, (aq) + H20(0) a. Write the net ionic equation for this reaction and identify the spectator ions. (If needed, use H3O+ for the hydronium ion. Use the lowest possible coefficients. Use the pull-down boxes to specify states such as (ag) or (3). If a...
Could you do both questions? Thank you in advance! 2. For the reaction below: a. Predict...
Could you do both questions?
Thank you in advance!
2. For the reaction below: a. Predict the most stable product(s) and draw the mechanism OK + E b. Redraw the product(s) below and label all the non-equivalent carbons. How many signals would you expect to see in the 13C NMR of the product? Predict the chemical shifts of each carbon below. c. Redraw the product(s) below and label all the non-equivalent hydrogens. How many signals would you expect to see...
Questions are a continuation of questions 2,3. Thank you for you help! I really need help...
Questions are a continuation of questions 2,3. Thank you for you
help! I really need help with just 3&4.
3.Suppose you wish to perform the reation you wrote in
problem 2 on the other -OH group.How might you prepare the molecule
in order to do so? Suggest appropiate reagents and draw your
expected products.
4. Suppose after your preparation performed in problem
3, the molecule reacts very slowly with HBr. How could you prepare
the -OH group you want to...
Hello, I was wondering if you could check my answers
27. Within wi:1.PBLSteatorn withthe Small stttomic radius a) Bi c) As 2nd is Sma lles S mall 28. Within Group 14, which of the following is the, most metallic elemen b Si Ge 29. Which of the following has an ionic radius that is smaller than its atomic radius? a) neon Nc nitrogen c) sodiuma sulfur 30. Which of the following molecules does not have a polar covalent bond? a)...
HiI was wondering if I could get help on solving this? I'm very
stuck on this question. Thank you!
Below is an image of a nucleic acid. Identify the pieces of nucleic acid. 0-P=O 0-2-0-0 LI Base to-2 HD -0-P=0 A. A, T, G, C, or U 3' Carbon with a phosphodiester bond to the next nucleotide in sequence C. In a molecule of RNA, the 2' hydroxyl would be here. D.5' Phosphate E. Ribose Sugar F. 5' Carbon G....
Hello! I am working on this genetics problem and was wondering
if you could check my letter d. I am not sure if this mRNA sequence
is correct and would really appreciate the help. Thank you!
4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...
please explain in detail. thank you in advance .
Consider the regioselectivity observed in these E2 reactions. Note that product A forms when the base (methoxide ion, CH,0) removes the proton from the carbon labeled B., while product B forms when the base removes the proton from the carbon labeled B2. Why is formation of the less highly substituted (less stable) double bond favored in product B? (1 pt) CHE B CHE A -- Reaction #1 CH, O product A...
Could you help me understand these please? I am struggling to
answer these.
Which of the following set of reagents would be the best choice to complete the following Suzuki-Miyaura reaction? Вона 2 cul Pd(OAC)2 но" 1. Tsci 2. PBI 1. Mg 2. CH,OH Pd(PPhala NaOE Oc Od O e ob Оа What is the most likely (major) product for the following reaction given a 1:1 ratio of reagents? HOJ - - BI - - O Tonly O III Only...
Hello! :) Could someone please assist me? Thank you in advance. I
appreciate you.
Q: What is the major product formed in each reaction?
13. What is the major product formed in each of the following reactions. CH,CH2CHCH3 + H2O DON BHs H2O2 (CH3)2 CH CH CH HO CH,CH=CH2 + HBr - CECH HgSO4 H20/H2SO4 x H2SO4 H2SO4 ethanol B & NOCH + NaOCH3 OH Na2Cr2O7 H2SO4 CH3NH2 + HBr HE OCH.CH
Hello, I am not sure what I am doing wrong.
Could someone please explain :)
Thank you!
The mineral dolomite contains magnesium carbonate. This reacts with hydrochloric acid. MgCO3(s) + 2 HCl(aq) + CO2(g) + MgCl, (aq) + H20(0) a. Write the net ionic equation for this reaction and identify the spectator ions. (If needed, use H3O+ for the hydronium ion. Use the lowest possible coefficients. Use the pull-down boxes to specify states such as (ag) or (3). If a...
Could you do both questions?
Thank you in advance!
2. For the reaction below: a. Predict the most stable product(s) and draw the mechanism OK + E b. Redraw the product(s) below and label all the non-equivalent carbons. How many signals would you expect to see in the 13C NMR of the product? Predict the chemical shifts of each carbon below. c. Redraw the product(s) below and label all the non-equivalent hydrogens. How many signals would you expect to see...
Questions are a continuation of questions 2,3. Thank you for you
help! I really need help with just 3&4.
3.Suppose you wish to perform the reation you wrote in
problem 2 on the other -OH group.How might you prepare the molecule
in order to do so? Suggest appropiate reagents and draw your
expected products.
4. Suppose after your preparation performed in problem
3, the molecule reacts very slowly with HBr. How could you prepare
the -OH group you want to...
Most questions answered within 3 hours.
-
A grammar is a 4-tuple G, G = (Ν, Σ, Π, Σ, S) where, Ν is...
asked 40 minutes ago -
In this part, calculate the present values. Use the Excel PV
function to compute the present...
asked 39 minutes ago -
Part 1. Primitive Types, Sorting, Recursion for
Homework.java
a) Implement the static method initializeArray that receives...
asked 1 hour ago -
Using C++, build a sorter that can rank a sequence of numbers in
a descending order....
asked 1 hour ago -
Derive ground state term symbols. Use notation 2S(1/2) for state
2S1/2
a) d5
b) f3
c)...
asked 2 hours ago -
A sample of size 31 will be drawn from a population with mean 39
and standard...
asked 2 hours ago -
What is the effect on the P-value when a test is changed from a
two-tailed hypothesis...
asked 2 hours ago -
I wish to estimate µ, the mean of a population. After I collect
and an-
alyze...
asked 3 hours ago -
At a local university, you poll a group of 115 students and find
that 37 of...
asked 2 hours ago -
Gladstone company tracks the number of units purchased and sold
throughout each accounting period but applies...
asked 3 hours ago -
When determining if a molecule's configuration is E or Z, what
determines the higher priority groups?
asked 3 hours ago -
13. What is the amount
of conversion cost transferred to finished goods? (Round
your intermediate calculations...
asked 3 hours ago