1. (C) Genetic engineering focuses on changing an organism's genome, while cloning focuses on exactly copying genetic material.
2. (E) Mosquito population can be controlled by the breeding of genetically modified mosquitoes.
3.(D) Thermocycler increases the temperature of the sample to denature the DNA so that the primers can anneal and Taq polymerase initiates DNA synthesis. Therefore, if thermocycler malfunctioned then the DNA strands would never separate, and the PCR would never begin.
4.(E) If a disease is controlled by more than one gene, then gene therapy will not be beneficial for that disease.
5.(A) The mutation prevents the channel protein from moving chloride across the membrane, resulting in thick, sticky mucus.
6. (C) CRISPR is a technique which is used by genetic engineers to edit the genome or a gene. Thus by using this technique, we can insert foreign DNA in a chromosome.
Please answer all the questions (1-6) Thank you. I’ll be sure to leave you a like...
PLEASE ANSWER ALL THE QUESTIONS: 1.What is true of tRNA (transfer RNA)? A they contain an anti-codon B they carry an amino acid C they can interpret the genetic code D all of these are true 2. How can transcription factors bound to distant enhancers influence gene expression? A the transcription factors can slide along the DNA until they get to the gene's promoter B DNA can loop, bringing these proteins into contact with the gene's promoter C both of...
For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...
can you please answer all the questions Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...
please answer all 6 questions Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
please answer all the question to get a like. Part III Dr. Hernandez sits down with Ann and her partner. The doctor is sorry to report that Ann has breast cancer; however, because it was caught early and responds to estrogen and progesterone, the prognosis is good. At this point it looks like the cancer is stage 1. However, as Ann is young, the doctor wants to perform a couple of tests. The first test is a genetic sequencing test...
please answer all 5! thank you! Question 1 1 pts Which of these individuals would be considered a 'mutant'? A person with an XO sex chromosome genotype The recessive allele for a straight hairline in humans A population of sunflowers which produce unique, red/orange petals, native to the southeastern tip of Kansas A turtle carrying an allele enabling it to wield a pair of daggers, present in only 0.0001% of the turtle population. Allele is expressed in dominant form prior...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...