Question

An individual with a trisomy has entirely typical chromosomal sequences, however the individual has striking traits that are called genetic. How can these traits be genetic when they are not caused by mutations in the sequence of nucleotides? Look at the following alignment. There is a mistake in the alignment. One insertion/deletion mutation was not identified. a) Indicate where in the alignment you would add dashes (-) to fix this alignment. How many dashes would you add? b) In the same alignment, do you see evidence for any base-change mutations? If so, where? Non-invasive prenatal testing (NIPT) is fundamentally based on DNA sequencing the blood of a pregnant person. We have had the technical capacity to sequence DNA for decades. Why was NIPT only developed in 2008?

Answer 1

13. Trisomy is a condition in a fetus.Usually, every cell in the human body has two copies of each of the 23 chromosomes.but sometimes due to improper separation of chromosomes during the cell division may lead to two copies of a chromosome and when the sperm and the egg cell fuse during fertilization the resulting zygote will have a total of three chromosomes of one type instead of two.Whichever chromosome number has three copies it is given a name for e.g, trisomy 21, trisomy 13.Meaning that the cells possess three copies of chromosome 21.

Usually, the extra copy of chromosomes doesn't show any mutations or alterations but its presence still has a huge effect on the physical and mental development of the individual.This happens due to the overexpression of many genes present on the chromosome 21 especially of amyloid-beta peptide which is reason for the plaques in Alzheimers disease, superoxide dismutase etc..,Finally though there are no mutations involved these are still genetic as they are inherited from the chromosomes of the parents and exclusively related to the genetic material.

14.

.

sea3 gaagctgtgaacgctaccctcgat -gaagctgtgaacgctaccctcgat--- ggaagctgtgaacgctatcgaccctcgatccttt ggaagctgtgaacgctatcgaccctcgatcc- seq seq5 seq2 seq4 aagctgtaacgctatcgaccctcgat-- -aggtgtaacgctatcgaccctcgatccttt

The above data was obtained by placing the sequences in the given order in a multiple sequence alignment CLUSTALW software (free online) It shows the places where one needs to add gaps and it does show base pair alterations such as C to G, G to T, C to T and so on.

15.NIPT is a noninvasive prenatal testing which primarily checks for the chromosomal abnormalities in the fetuses by testing the circulating fetal free DNA in the maternal circulation and compare them with the normal cells present and any odd numbered chromosomes will be monitored.

In 2008 the Abortion law has been reformed which gave women the right to choose to retain a pregnancy or to abort it.It also gave the clearance for the prenatal test to all.Which was earlier thought as a reason to increase in the abortion rate.