Question

Animal Science Cell and Molecular Biology Quesiton --

The bolded sequence in the sequence in question 5 is a variable number tandem repeat sequence (VNTR or STR). The following table shows the PCR product lengths amplified using the primers you designed in question 5 and DNA samples from four sets of skeletal remains found buried in an archaeological excavation. List the VNTR lengths for the two alleles for each skeleton in the table below.

5. Design 15 nucleotide long PCR primers from the beginning and end Cuse the underlined sequences of the following sequence (grouped into ten nucleotide blocks), writing the forward and reverse primers in the 5' to 3' direction. 5'- GCTGT CACAG TCGATCGCAT GCACGTCGAG CTACGTAAGT GTGACGATCG ATCGATACGT TTACGATTAC GCGATCAGCT GCTCGAGCAC GCTCGAGCAC GCTCGAGCAC GCTCGAGCACGCTCGAGCAC CGCGCATTTA CGATCGATCA GCTTTAC GAC GCAGATTTAT-3' (1 point) (i) Forward primer: 5 Reverse primer: 5 (ii) What is the size of the PCR product amplified from the template shown (include units)? 6. The bolded sequence in the sequence in question 5 is a variable number tandem repeat sequence (VNTR or STR). The following table shows the PCR product lengths amplified using the primers you designed in question 5 and DNA samples from four sets of skeletal remains found buried in an archaeological excavation. List the VNTR lengths for the two alleles for each skeleton in the table below Skeleton identification and PCR product lengths (bp) VNTR lengths gender A, female 210, 180 B, male 210, 150 180, 150 C, male 170, 220 D, female E, male 210,210 (i) Which skeleton is a potential mother? (ii) Which skeleton is a potential father? (iii) Which skeleton(s) are potential children of the other skeletons?

Answer 1

According to HomeworkLib minimum protocol i have to answer first full question ...

hope it helps .... Regars

0s Lemn prim I t