QUESTION 12
Remember that a palindrome sequence is the nucleotide sequence that can be read forward or reverse in the same way. As you can see, in option A, if you read in direction 5’ to 3’ and 3’ to 5’, the sequence will be the same. So, the correct answer is 5’CCGATCGATCCC-3’
QUESTION 13
In this case, you need to choose the complementary strand of the sequence but in the reverse direction. CGAT - ATCG
So, to correct answer is ATCG
Which of the following sequences includes a clear 8 base pair palindrome? O5' -- CCGATCGATCCC --...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
Question Which of the following pairs is not a conjugate acid-base pair? Онсин O OH102- OH202/1H02 O NHI*NH: O H2O/OH
TASK Your task is to build a palindrome from an input string. A palindrome is a word that reads the same backward or forward. Your code will take the first 5 characters of the user input, and create a 9- character palindrome from it. Words shorter than 5 characters will result in a runtime error when you run your code. This is acceptable for this exercise – we will cover input validation in a later class. Some examples of input...
Question 8 3 pts Which of the following is not a conjugate acid/base pair? O HC2H302/C2H302" O NH4+/NH3 CO2/C03 OH3PO4/H2PO4 Question 9 3 pts A 1.0 M solution of NaC2H3O2 in water is expected to be: Acidic because sodium acetate undergoes hydrolysis Neutral because sodium acetate is a salt Basic because acetate ion is the conjugate base of acetic acid Acidic because it forms acetic acid Question 10 3 pts Examples of ionizing radiation would include: infrared (IR) visible light...
Which of the following is not a conjugate acid-base pair? O H30*/OH O NH4+/NH3 O H2SO3/HSO3 O All of these are conjugate acid-base pairs.
(2pts) Which of the following statements does NOT accurately describe enhancer sequences: A. Enhancer sequences can be located far away from the promoter that it regulates B. Enhancer sequences are cis-acting regulatory elements C. Enhancer sequences can be located either upstream (5’) or downstream (3’) the gene D.Enhancer sequences are located within 10 to 35 base pairs upstream of the promoter When bound by transcription factors, enhancer sequences enhance gene expression
Question 8 of 68 Which of the following is a conjugate acid/base pair? A) H3PO, PO, B) H,PO.. PO C) HPO 7.POA" D) H3PO4, HPO,
11. which of the following pairs of species is a conjugate acid-base pair? a. NaF, F b. NHs, NH c. H30+, ОН- d. H2CO3, CO32 8. which of the following salts is most likely to form an aqueous solution having the pH <7? a. NaBr b. LiNO3 c. NH4CI d. RbCN 2. which of the following pairs of species is not a conjugate acid-base pair? a. OH, H b. HOCI, OCh c. HSO4,SO42 d. H2CO3, HCO3 11. which of the...
8) Which of the following is a conjugate acid-base pair? F and NaF [2] CH3COOH and CH3Coo [31 NH3 and NO3 [4] Cl2 and Cl [5] HCI and HCIO4
Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are tandem (next to each other) repeats of short sequences (a few bp). Such tandem repeats are located at specific sites scattered throughout the genome. Individuals vary in the number of repeats at each site sites can have up to 100 repeats. Each locus with the same repeats is called an SSR ocus DNA was extracted from Sam's white blood cells and cut with a...