Question

: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate...

: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b. Type of molecule & its length c. Scientific name & common name of organism Report for Electrophorus electricus alignment d. Number of iteration until obtaining the hit of Electrophorus electricus e. Bit score, raw score, E-value f. Identity, positive/similarity, gap g. The range length

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question

P04637 is cellular tumor antigen p53 is present in human. When this protein is used as a query against Electrophorus electricus. The result of the PSI blast is:

select all 14 sequences selected PSI-BLAST iteration 2 Max Total Query Evalue Select for PSI Per. Ident Used to Newly build aFigure: PSI BLAST Result

cellular tumor antigen p53 isoform X3 (Electrophorus electricus) Sequence ID:XP_026854216.1 Length: 409 Number of Matches: 1Figure: Descriptive result

TIUVI. III.I .YUV LOCUS XP_026854216 409 aa linear VRT 08-NOV-2018 DEFINITION cellular tumor antigen p53 isoform X3 ElectrophFigure: Locus, gene name

a. The locus as given in the result is XP_026854216.

The gene name is cellular tumor antigen p53 isoform

b. The type of molecule is protein and its length is 409 amino acid.

c. Scientific name is

Electrophorus electricus

Common name is electric eel

d. Number of iteration 2

e. Range 1:33 to 409 Genpept Graphics Next Match Previous Match Related Information Score Expect Method Identities Positives 578

Add a comment
Know the answer?
Add Answer to:
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • E-value for microbial computational genomics/genetics? Particularly need help with 1a, but if you can help with...

    E-value for microbial computational genomics/genetics? Particularly need help with 1a, but if you can help with any of the rest that would be great! Thanks in advance! 1. As discussed in the final computational lecture, PSI-BLAST' is an iterative multiple sequence alignment technique that starts with a single protein query of database search by pairwise alignment. The resulting pairwise alignments from that search are collated and analyzed to create a PSSM (position specific substitution matrix) which is subsequently used in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT