: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b. Type of molecule & its length c. Scientific name & common name of organism Report for Electrophorus electricus alignment d. Number of iteration until obtaining the hit of Electrophorus electricus e. Bit score, raw score, E-value f. Identity, positive/similarity, gap g. The range length
Question
P04637 is cellular tumor antigen p53 is present in human. When this protein is used as a query against Electrophorus electricus. The result of the PSI blast is:
Figure: PSI BLAST Result
Figure: Descriptive result
Figure: Locus, gene name
a. The locus as given in the result is XP_026854216.
The gene name is cellular tumor antigen p53 isoform
b. The type of molecule is protein and its length is 409 amino acid.
c. Scientific name is
Electrophorus electricus
Common name is electric eel
d. Number of iteration 2
e.
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
E-value for microbial computational genomics/genetics? Particularly need help with 1a, but if you can help with any of the rest that would be great! Thanks in advance! 1. As discussed in the final computational lecture, PSI-BLAST' is an iterative multiple sequence alignment technique that starts with a single protein query of database search by pairwise alignment. The resulting pairwise alignments from that search are collated and analyzed to create a PSSM (position specific substitution matrix) which is subsequently used in...