The DSM-IV is a diagnostic guide that:
describes psychological disorders and their causes. |
has been shown to have poor reliability and validity. |
describes only disorders that have medical causes. |
describes psychological disorders and their prevalence. |
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
The DSM-IV is a diagnostic guide that: describes psychological disorders and their causes. has been shown...
1. A psychological disorder can be described as any behavior or emotional state that: a. causes an individual great suffering or worry b. endangers others c. is self-destructive d. impairs the individual's ability to get along with others e. all of the above 2. Which of the following questions will be most helpful in determining whether a particular behavior is considered abnormal, and therefore, potentially a disorder? a. Is the behavior considered deviant (i.e., socially unacceptable) in one's culture? b.Is...
1) The Diagnostic and Statistical Manual of Mental Disorders is in its 5th revision. This manual serves as a major diagnostic reference for mental health professionals, but it is not without controversy. This week, using peer-reviewed sources and your text as empirical support, post examples of controversial elements of the new revision. For example, Asperger’s Disorder has been removed and is now part of the Autism Spectrum Disorder. How has the medical community reacted to this and other changes? What...
Chapter 15 Psychological Disorders: What is Abnormal? (23 marks) Rationale: The purpose of this activity is to review criterion for psychological disorders. PART 1: Instructions: For the exercise below, review the criteria we talked about in class used for assessing abnormal behavior. Then, for each scenario below, pick ONE criteria that you believe applies. Write down what the criteria is under each scenario, and provide a very brief (one or two sentence) explanation why this scenario demonstrates that criteria What...
Question 1 What might a proponent of evolutionary medicine hypothesize about psychological disorders, such as anxiety and obsessive compulsive disorder (OCD)? OCD likely results from an evolutionary mismatch between psychological traits that were adaptive in hunter gatherer society but cause stress in modern society OCD likely results from a maladaptive psychological trait that would have led to an early death in hunter gatherer society OCD is likely to be an adaptive trait in both hunter gatherer society and in modern...
Question 1 What might a proponent of evolutionary medicine hypothesize about psychological disorders, such as anxiety and obsessive compulsive disorder (OCD)? OCD likely results from an evolutionary mismatch between psychological traits that were adaptive in hunter gatherer society but cause stress in modern society OCD likely results from a maladaptive psychological trait that would have led to an early death in hunter gatherer society OCD is likely to be an adaptive trait in both hunter gatherer society and in modern...
Murray has been diagnosed with social anxiety. His therapist's practice aligns closely with the psychological theory of abnormality that focuses on psychodynamic explanations of psychological disorders. Which explanation is Murray's therapist MOST likely to give to explain Murray's social anxiety? Murray's interactions with people were punished when they resulted in embarrassment Murray expresses an unusually high level of neuroticism and introversion. Murray subconsciously expects people to leave him since he was abandoned by his father. Murray's thought process is illogical...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
I don't have more information A 42-year-old female patient has been scheduled for a diagnostic laparoscopy to search for any pathology causing her chronic pelvic pain. While in the preoperative holding area, a registered nurse (RN) performed the nursing evaluation: checked the patient's documentation, history and physical, allergies, and special needs, while providing emotional support. The anesthesia care provider reviewed the surgical steps and started an IV line. The RN and an OR nursing assistant bring the patient on the...
Accounting study guide help So iv mostly been getting stuck on making the functions work and doing the part were its saying don't use cell references to the values Plant Assets, Natural Resources, and Intangibles Using Excel to prepare depreciation schedules The Fraser River Corporation has purchased a new piece of factory equipment on January 1, 2018, and wishes to compare three depreciation methods: straight-line, double-declining-balance, and units-of-production. The equipment costs $400,000 and has an estimated useful life of four...
QUESTION 21 In 1973 David Rosenhan published a seminal study called "On Being Sane in Insane Places" where he reported the results of his experiment in which he sent 8 healthy "pseudopatients" including himself to be evaluated for a psychiatric facility. All of them reported hearing auditory hallucinations and nothing else - they all were admitted and diagnosed with mental illnesses. Once admitted they reported no further symptoms and told staff they felt fine and no longer experienced auditory hallucinations...