Homework Answers
Add Answer to:
If one strand of DNA has the sequence C-T-A-C-C-G-T-T-A, what sequence would appear opposite it on...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
A strand of DNA has the base sequence GATTCA
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?
Give the sequence of the complementary strand of the following DNA of one DNA strand of...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
The following is a strand of DNA. What would be the sequence of the complimentary strand...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in...
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
1.) What are the bases that would make up the complementary strand for the DNA sequence...
1.) What are the bases that would make up the complementary strand for the DNA sequence CGATTAGTTTACC? 2.) A relative has been to the doctor and comes back with the good news that the tumor they discovered in their abdomen was a harmless, non-cancerous one. They know this because the doctor said the tumor was_________ a. Carcinogenic b. Metastatic c. Benign d. Malignant e. Ectopic
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Most questions answered within 3 hours.
-
13. What area of software development focuses on the user's
reaction to and interaction with the...
asked 22 minutes ago -
A ball is dropped from a height h. Another ball is
launched vertically . The two...
asked 43 minutes ago -
R3. 81:
A newspaper reported that the revenue trends for the past five
years were up...
asked 1 hour ago -
The decomposition of XY is second order in XY and has a rate
constant of 7.06×10−3...
asked 2 hours ago -
A three-phase induction motor is to be supplied through a 50
meter length.Determine the conductor size...
asked 2 hours ago -
A duopoly faces the following demand curve, Q = 30 - P (also P =
30...
asked 2 hours ago -
a reaction is second order with respect to one of its
reactants. By what factor will...
asked 2 hours ago -
anwser question 13 and 14
13. Data intergrity is a big deal in industry. why ?...
asked 3 hours ago -
26) Suppose the L and M genes are on the same chromosome but
separated by 100...
asked 3 hours ago -
A suggestion is made that the proportion of people who have food
allergies and/or sensitivities is...
asked 5 hours ago -
A refrigerator operates between temperatures of 294 and 253 K.
What would be its maximum coefficient...
asked 6 hours ago -
CHEM 2 (Step by step explanation please prefer if it were
handwritten)
A 100 mL aqueous...
asked 6 hours ago