Homework Answers
The given sequence is 5’-GGATTTTTGTCCACAATCA-3’
The answer for question no. 34 is “C
Complementary sequence would be 3’-CCTAAAAACAGGTGTTAGT-5’
Explanation: In DNA double strand the base pairing is complementary Adenine(A) always pairs with Thymine and vice versa. Guanine(G) always pairs with Cytosine(C).
The DNA strands are antiparallel to each other hence the complementary strand will be run in 3’ to 5’ direction.
Answer 35: “B” 19%G,19% C,31%T
Explanation: Chloroplast DNA is smaller and circular as against nuclear DNA.
The base pairing rules remain the same A pairs with T and G pairs with C
If the percentage of adenine is 31% then the percentage of thymine will be equal to 31% as adenine is always paired with thymine.
A+T = 62% then remaining percentage i.e 38% will be equal to G+C
Therefore G will be 19% and C will be 19%
Add Answer to:
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...
The sequence below is found in a DNA double helix. Fill in the complementary strand and...
The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group
5) The following sequence of bases is present along one chain of a DNA double-helix that...
5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...
Give the sequence of the complementary strand of the following DNA of one DNA strand of...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
48) If one strand of a DNA double helix ha one strand of a DNA double...
48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand? A) GACGTCA B) AGTACTGC) GTCATGAD) TCATGAC 49) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU 50) what group(s) in amino acid carboxyl and Amino D) Hydroxyl and Carboxyl B) carbonyl and Amino C) Hydroxyl and Carbonyl
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points ...
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
Select the phrases that accurately describe properties of the most common form of the DNA double helix
Select the phrases that accurately describe properties of the most common form of the DNA double helix. There is more than one correct answer. Select all that apply. DNA contains equal amounts of adenine and thymine, and equal amounts of cytosine and guanine. A helical turn consists of about 10 nucleotides. Base pairs have a spacing of 20 A. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of...
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A)...
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is...
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC
The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand? A) GACGTCA B) AGTACTGC) GTCATGAD) TCATGAC 49) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU 50) what group(s) in amino acid carboxyl and Amino D) Hydroxyl and Carboxyl B) carbonyl and Amino C) Hydroxyl and Carbonyl
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC
Most questions answered within 3 hours.
-
Mr. and Mrs. Brown report taxable income of $130,000 in 2018. In
addition, they report the...
asked 1 hour ago -
You capture data by having 8 people fill in 30 small dots on a
piece of...
asked 5 hours ago -
What are the z-values such that 70% of the area lies in the
middle of the...
asked 7 hours ago -
You borrow $29,500 to purchase a brand new car. The interest
rate is 6%, and the...
asked 6 hours ago -
The amount of time it takes an asteroid, whose average distance
from the Sun is 4.70...
asked 7 hours ago -
A 0.289 kg mass slides on a frictionless floor with a speed of
1.34 m/s. The...
asked 7 hours ago -
15.A box contains five red balls, three green balls, and two
yellow balls. Suppose you select...
asked 10 hours ago -
Assume you are given the following for Stackelberg industries:
Return on Assets (ROA) = 8%
Debt...
asked 8 hours ago -
an engineer proposes to use mmWave in 5G network to
increase data rate.
What are the...
asked 8 hours ago -
Explain the idea behind using SEMIJOIN in distributed
query processing.
asked 8 hours ago -
why
is context important in selecting and applying guidelines and
principles for interface design?
illustrate your...
asked 8 hours ago -
In a certain board game, a player rolls two fair six-sided dice
until the player rolls...
asked 9 hours ago