Question

48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequen
0 0
Add a comment Improve this question Transcribed image text
Answer #1

haling about melembar belogy. Hello, today we are going to discuss about a questions 46. 1) ICATGAL In here, its given that tMATICAACT. The equlwalent RNA skand will be UGUU CHACU. Instead q Theymine, the RNA possess chaul. The wraules less stable t

In case of any query please comment. If you have liked the solution then please THUMBS UP.

Add a comment
Know the answer?
Add Answer to:
48) If one strand of a DNA double helix ha one strand of a DNA double...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is...

    If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

  • help 7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands...

    help 7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands and two old strands. Bone new and one old strand in each helix C)three new strands in one helix and three old strands in the second helix D)two new and one old strand in one helix and two old and one new strand in the second helix E two new strands in one helix and two old strands in the other helix. 8) A...

  • 14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...

    14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...

  • What is the relationship of the new strand of a daughter DNA double helix and the...

    What is the relationship of the new strand of a daughter DNA double helix and the old strand in the other daughter DNA double helix?

  • 44. During DNA replication, the double helix is unwound, creating two single strands. One of these...

    44. During DNA replication, the double helix is unwound, creating two single strands. One of these is called the strand, on which the progress of DNA Polymerase III is – 45. The other strand is called the strand, on which the synthesis is 16. During DNA replication, synthesis of a new sequence on the Leading Strand is continuous. Why is synthesis on the Lagging Strand discontinuous? 47. Generation of Okazaki fragments proceeds in three steps. Indicate which of the following...

  • The sequence below is found in a DNA double helix. Fill in the complementary strand and...

    The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT