ZuoTi.Pro
Question

If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand compliment
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)

All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Similar Homework Help Questions

  • 48) If one strand of a DNA double helix ha one strand of a DNA double...

    48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand? A) GACGTCA B) AGTACTGC) GTCATGAD) TCATGAC 49) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU 50) what group(s) in amino acid carboxyl and Amino D) Hydroxyl and Carboxyl B) carbonyl and Amino C) Hydroxyl and Carbonyl

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

  • The sequence below is found in a DNA double helix. Fill in the complementary strand and...

    The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group

  • What is the relationship of the new strand of a daughter DNA double helix and the...

    What is the relationship of the new strand of a daughter DNA double helix and the old strand in the other daughter DNA double helix?

  • Give the sequence of the complementary strand of the following DNA of one DNA strand of...

    Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...

  • Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A)...

    Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • The following is a strand of DNA. What would be the sequence of the complimentary strand...

    The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC

  • 1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric...

    1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric helix–turn–helix protein binds to a DNA fragment containing this sequence. Its preferred half-site is AACAC. Show where the two recognition helices in the protein contact the DNA. B. Are protein–DNA contacts primarily in the major or the minor groove of DNA? What parts of the nucleotides contact the amino acid side chains of the protein to provide most sequence specificity? What kind of bond...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT