ZuoTi.Pro
Question

Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5)GCGCAATATTCTCAAAATAT(3). A) Write
science   chemistry   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

(a) (3')CGCGTTATAAGAGTTTTATA(5')

(B)   the two chains that make up a double helix of DNA, with corresponding positions on the two chains being composed of a pair of complementary bases. a section of one nucleic acid chain that is bonded to another by a sequence of base pairs. the complementary base pair include in DNA include ADENINE IS PAIRED WITH THYMINE AND GUANINE IS PAIRED WITH CYTOSINE, when the parent strand contains a sequence of this sequence in a particular order running from 5'-3' end and the other strand contains those pairs complementary to the parent strand running from 3'-5' end are called complementary strands

0 0
Add a comment
Know the answer?
Add Answer to:
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A)...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...

    Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'

  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • 5. Nucleic acids A region of DNA has a sequence 5'- TTAGCCTC-3' A. Write the complementary...

    5. Nucleic acids A region of DNA has a sequence 5'- TTAGCCTC-3' A. Write the complementary sequence for this strand. B. How many purines are in the new strand? C. Why is the monomer of nucleic acids different from a monomer of carbohydrates?

  • If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is...

    If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC

  • The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...

    The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT