Write the base sequence of the complementary strand... (Please explain! thank you)
To find out the sequence of complementary strand, you just have to write adenine in place of thymine and vice versa. And you have to write guanine in place of fytofin and vice versa.
This is because adenine pairs with thymine by two hydrogen bonds and vice versa guanine pairs with cytosine by 3 hydrogen bond and vice versa.
Palindromic sequences are those which read the same in both the strands, that is they have a same sequence in the upper and in the lower strand.
Mirror repeat are those with repeat themselves after a certain stretch of nucleotides and appear as mirror images to each other.
Please rate high.
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
Please help me to answer this: Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5' ACGTAG 3'
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...
For the following DNA strand: ATTTTAAGCTAAGCTCCA (a) Write the complementary strand, (b) Calculate the number of hydrogen bonds existing between the strands, (c) Specify the 5’ and 3’ ends for each strand.
The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group