Please help me to answer this: Give the base sequence of the complementary DNA strand of...
Please help me to answer this: Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5' ACGTAG 3'
Homework Answers
Add Answer to:
Please help me to answer this: Give the base sequence of the
complementary DNA strand of...
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Give the sequence of the complementary strand of the following DNA of one DNA strand of...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Given this sequence of DNA bases (AGCTATACG) give a complementary strand. Also provide the name of...
Given this sequence of DNA bases (AGCTATACG) give a complementary strand. Also provide the name of each base, A G C T.
A strand of DNA has the base sequence GATTCA
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in...
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Most questions answered within 3 hours.
-
1. The correlation coefficient determined for two variables has
a value of 0.89. Describe, in words,...
asked 3 minutes ago -
The following data relate to direct materials costs for
November:
Actual costs
4,700 pounds at $5.35...
asked 1 minute ago -
Kyle, a 95.0 kg football player, leaps straight up into the air
(with no horizontal velocity)...
asked 25 minutes ago -
Which of the following is a measure of profitability?
A.
Quick (acid-test) ratio
B.
Net sales...
asked 28 minutes ago -
Find the total pressure exerted by 2 grams of ethane and 3 grams
of CO2 contained...
asked 29 minutes ago -
A fireman standing on a 5.2 m high ladder operates a water hose
with a round...
asked 25 minutes ago -
A cream formulation is studied for accelerated stability study.
Creaming was observed when formulation was tested...
asked 28 minutes ago -
A 1,150 lumen light bulb is placed 37 cm in front of a mirrored
wall, whose...
asked 39 minutes ago -
Given that z is a standard normal random variable, compute the
following probabilities (to 4 decimals)....
asked 45 minutes ago -
You begin preparation of the calibration curve to measure
absorbance vs concentration of FeSCN2+. To do...
asked 1 hour ago -
When you speak after breathing helium, in which the speed of
sound is much greater than...
asked 55 minutes ago -
3. Stock Valuation: You are the CEO of Under Armour, Inc. and
are thinking about how...
asked 59 minutes ago