Given this sequence of DNA bases (AGCTATACG) give a complementary
strand. Also provide the name of each base, A G C T.
Given this sequence of DNA bases (AGCTATACG) give a complementary strand. Also provide the name of...
Please help me to answer this: Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5' ACGTAG 3'
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always match with each other Adenine--Thymine and Cytosine--Guanine. AGCCCGTCTTGGAAT
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
1.) What are the bases that would make up the complementary strand for the DNA sequence CGATTAGTTTACC? 2.) A relative has been to the doctor and comes back with the good news that the tumor they discovered in their abdomen was a harmless, non-cancerous one. They know this because the doctor said the tumor was_________ a. Carcinogenic b. Metastatic c. Benign d. Malignant e. Ectopic
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'