please rate
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand c) nucleotide tRNA sequence
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC