would you just multiply everything straight across ir divide it? (89.5 x 106 c. 6.626x10-34).s
How would you combine reactions A-C, shown below, to obtain the overall reaction: NH, () +BH2(g)+0,(3) —> 2H,0(g) +HBNH(s) Please select all that apply. 24,(g) +0,(g) → 24,0(3) H BNHz() NH3(g) +BH3(g) HBNH,(s) -> 2H, (g) + HBNH(s) Choose one or more: A multiply A by 2 B. add resulting equations together C. multiply C by 2 D. reverse A E. divide A by 2 E multiply B by 2 G divide B by 2 H. divide C by 2...
Kirchhoft s law says that if you trace a path around any c age sources less the sum of the voltage drops must equal zero. Keeping in mind Ohm s Law, V IR, for the simple RC circuit shown in Figure 1 on the previous page where the power supply is hooked the capacitor is charging, Kirchhoff s law would say that aw says that if you trace a path around any closed-loop within a circuit, the sum of the...
LSM 5 Part C. Suppose that you are walking on a straight line. You start at position X, -0, and only walk in the positive direction. Your positions afcer taking the ith step is denoted by X,. For each step, your step size, denoted by S, = X,-X,-ı , is a random variable uniformly distributed between 1 foot and 2 eet. Assume that sizes of different steps are mutually independent. 8. (10 credits) Let Xy be your position after taking...
Just 34 please CHAPTER 2 33. You are exploring the music in your iTunes library. The total play counts over the past year for the 27 songs on your "smart playlist" are shown below. Make a frequency distribution of the counts and describe its shape. It is often claimed that a small fraction of a person's songs will account for most of their total plays. Does this seem to be the case here? ILE, please vist 128 58 54 91...
LSM 5 Part C. Suppose that you are walking on a straight line. You start at position Xo , and only walk in the positive direction. Your positions after taking the ith step is denoted by X,. For each step, your step size, denoted by S, . X,-X,-ı , is a random variable uniformly distributed between 1 foot and 2 feet. Assume that sizes of different steps are mutually independent 8. (10 credits) Let X, be your position after taking...
Any help would be appreciated! S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he...
10 and 11 please LSM 5 Part C. Suppose that you are walking on a straight line. You start at position Xo =0, and only walk in the positive direction. Your positions after taking the ith step is denoted by X,. For each step, your step size, denoted by S, feet. Assume that sizes of different steps are m 8. (10 credits) Let Xy be your position after taking N steps where N is a given = X,-X,-, is a...
8- Suppose that you noticed the following prices: C=$12; S=$60; X=$50, for a one year European call option. The simple risk-free interest rate is 10% per year. Is there an arbitrage profit opportunity here? Yes or no? If yes, how would you exploit it? If no, explain why not. PS: In all questions above X denotes the exercise price of the options, C=call premium, P=put premium, and S=stock price.
In details plz Thank you! Suppose that X ~ Gamma(a, b) and Y ~ Chisquare(k) and X and Y are independent. Îet w = X+Y (a) Find the MGF of W. / (b) For what value(s) of b would W be a Gamma Random Variable? What would its parameters be? (c) For what value(s) of b and a would W be a ChiSquare Random Variable? What would its parameter be? (d) For what value(a) of b, a, and k would...
2) Chimichanga Fest Your utility function is given by U-X,X, where xi s your consumption of Chimichangas and x, is your consumption of all the other goods in the economy. Yes, you spend 60% of your budget on Chimichangas, which is totally reasonable after the Dumpling House tragedy. a) Solve the utility maximization problem, finding the uncompensated demand for x, & x, and the indirect utility function in terms of p,, p, and Y. b) Solve the expenditure minimization problem,...