Question

Any help would be appreciated!

S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he desired started DNA Insert Sequence -GCACGGGGATATCCTGCAGTAATGAAACTGGGATCCGTGGATTAGAACTGCAGGTCGACTGAC CGTGCCCCTATAGGACGTCATTACTTTGACCCTAGGCACCTAATCTTGACGTCCAGCTGACTO a) During the first step of the plasmid mutation insertion experiment, you need to use a restriction endonuclease. Which one of the following listed would you suggest. Explain why. (Note: Writing a restricted with will Perhaps s ing where the plumb for each using different colors will always (12 pts) Sall BamHI Hind!! Pst! EcoRV b) Upon insertion of the new DNA sequence into the plasmid, you synthesize your "mutant" heptapeptide and compare it to the original sequence (the "wild-type"). However, upon experimentation, you find that no differences are distinguishable between the mutant and wild-type. Therefore, you go back and make sure you have done everything you set out to do in the experiment. As part of this check-up, determine the amino acid sequence for each of the plasmids above (from start to stop codon). The sequences above have been provided below for this exercise. Make sure you label the N terminal and C-terminal ends of the peptide sequence and use 3-letter designations (12 pis Wild-type Sequence -TCGAGCCGATATCCTGCAGCGATGAAGCTTGGTAGCGTCGACTAACACTGCAGGTCGACCCTT- AGCTCGGCTATAGGACGTCGCTACTT GAACCATCGCAGCTGATTGTGACGTCCAGCTGGGAA- Mutant Sequence GCACGGGGATATCCTGCAGTAATGAAACTGGGATCCGTGGATTAGAACTGCAGGTCGACTGA -CGTGCCCCTATAGGACGTCATTACTTTGACCCTAGGCACCTAATCTTGACGTCCAGCTGACTO

Answer 1

4 a. During the first step of the plasmid mutation experiment, HindIII restriction endonuclease can be used. Among the listed endonuclease enzyme only the HindIII site is present in the provided plasmid sequence. During insertion of of a DNA fragment, the insert should not have the site for the restriction enzyme and in the given insert sequence, there is not site for HindIII however, the insert has a restriction site for SalI, and BamHI. So SalI and BamHI cannot be used during the experiment. For PstI, there is no site for PstI in the plasmid, as a result, it cannot be used during the process. Below is the diagram for cutting site of HindIII in the plasmid fragment.

5' TCGAGCCGATATCCTGCAGCGATGAAGCTTGGTAGCGTCGACTAACACTGCAGGTCGACCCTT 3' 3' AGCTCGGCTATAGGACGTCGCTACTTCGAACCATCGCTCGTGATTGTGACGTCCAGCTGGGAA 5' Hindill site