Question

5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond?

genetic biology

Answer 1

3. a) Primase enzyme makes an RNA primer, or short stretch of nucleic acid complementary to template, that provides 3' end for DNA polymerase to work on.

b) 3'CGTACTCAGACCATGCGAAAATTTCG5'

c) Phosphodiester bond

Mutations- Transversion

Transition

Induced point mutations

a) At the elongation stage expansion occurs.It includes repeat expansion within exon 1 of gene.

b) probability is 50 percent. because Prisha is a carrier.

Someone with autosomal dominant FALS has one copy of the gene with a mutation and one copy of the gene without a mutation. A child born to someone with FALS has a 50% chance of inheriting the FALS gene mutation and a 50% chance of inheriting the gene without the mutation.

Attaching image of trinucleotide DNA

DMTOO Base RO-P=0 07 Base RO-P=0 0-0 Basez R= c N ON CH3 H3C^CH3

NH3 | 0 0— P=0 го—p=0 N NH2 о с нь дун o-p=0 тг Осн, сухо 0 ОН The DNA trinucleotide C-G-T

one of the major structural differences between DNA and RNA is sugar with the 2-deoxyribose in the DNA being replaced by ribose in RNA.

a) according to image B is a leading strand synthesize continuosly and  D is a lagging strand.

b) multiple proteins are required, DNA polymerase, SS DNA binding protein, Helicases, primase, topoisomerases and DNA gyrases.

c) telomerase adds complementary RNA bases to 3'end of DNA strand. so according to the image A will need to have telomerase activity.They function to protect the end of chromosomes from sticking to each other. They also protect genetic information during cell division because a short piece of each chromosome is lost every time its DNA is replicated.