Homework Answers
between T14 and G15, insert AA.
From the mutated amino acid sequence, we can understand that a frameshift mutation had taken place which had given rise to a stop codon and truncated protein is been produced. Frameshift is possible for insertion and deletion mutations. Now, if you do trial and error between the options you will identify that insertion of AA between T14 and G15.
Add Answer to:
Question 9 (1 point) Figure out the mutation. You will need the codon table for this...
Question 20 (1 point) Figure out the mutation. You will need the codon table to answer...
Question 20 (1 point) Figure out the mutation. You will need the codon table to answer this question. Wild type genomic sequence of a portion of a gene and the wild type sequence of portion of the protein gene product. The protein sequence only matches partially. TAT AAA GGG CGA CCA CCT GGT AAT GGG ACT TTG AGG Tyr Lys Gly Arg Pro Pro Ala Pro Arg Gin Tyr Trp Note: The five amino acids at the amino end of...
Question 11 (1 point) Figure out the mutation. You will need the codon table for this...
Question 11 (1 point) Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a portion of the ORF for a eukaryotic gene and matching amino acid sequence of that portion of its gene product. ATA GTG CGC TGT AGA CTC TAT GCG TCT GAG TCT ACG Ile Val Arg Cys Arg Leu Tyr Ala Ser Glu Ser Thr A mutant is found that has the following protein sequence: lle Val Arg Cys...
Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...
Adenosine deaminases modify adenosines to form
_____________________, which is then read as
_________________________ by the translation and splicing systems,
as well as by reverse transcriptase.
Cephalopods like squid and octopus use this form of editing very
extensively in their protein-coding regions. For each of
the following, please indicate how these enzymes can alter the mRNA
to produce the indicated codon changes.
I (Ileu) is changed to V (val):
K (Lys) is changed to E (Glu):
T (Thr) is changed to A (ala):...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Shown below is a polylinker that falls within the B-galactosidase coding region of the lacZ gene....
Shown below is a polylinker that falls within the B-galactosidase coding region of the lacZ gene. This polylinker serves as a cloning site in a fusion protein expression vector where the cloned insert is expressed as a ß-galactosidase fusion protein. 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 6 Met Thr Met lle Thr Asn Ser Pro Asp Pro Ser Thr Cys Arg Ser Thr Asp Pro Gly Asn...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Question 20 (1 point) Figure out the mutation. You will need the codon table to answer this question. Wild type genomic sequence of a portion of a gene and the wild type sequence of portion of the protein gene product. The protein sequence only matches partially. TAT AAA GGG CGA CCA CCT GGT AAT GGG ACT TTG AGG Tyr Lys Gly Arg Pro Pro Ala Pro Arg Gin Tyr Trp Note: The five amino acids at the amino end of...
Question 11 (1 point) Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a portion of the ORF for a eukaryotic gene and matching amino acid sequence of that portion of its gene product. ATA GTG CGC TGT AGA CTC TAT GCG TCT GAG TCT ACG Ile Val Arg Cys Arg Leu Tyr Ala Ser Glu Ser Thr A mutant is found that has the following protein sequence: lle Val Arg Cys...
Adenosine deaminases modify adenosines to form
_____________________, which is then read as
_________________________ by the translation and splicing systems,
as well as by reverse transcriptase.
Cephalopods like squid and octopus use this form of editing very
extensively in their protein-coding regions. For each of
the following, please indicate how these enzymes can alter the mRNA
to produce the indicated codon changes.
I (Ileu) is changed to V (val):
K (Lys) is changed to E (Glu):
T (Thr) is changed to A (ala):...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Shown below is a polylinker that falls within the B-galactosidase coding region of the lacZ gene. This polylinker serves as a cloning site in a fusion protein expression vector where the cloned insert is expressed as a ß-galactosidase fusion protein. 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 6 Met Thr Met lle Thr Asn Ser Pro Asp Pro Ser Thr Cys Arg Ser Thr Asp Pro Gly Asn...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Most questions answered within 3 hours.
-
With a $16 Trillion national ebt, and projected annual budget
eficits in excess of $1 Trillion...
asked 13 minutes ago -
A machine shop owner wishes to assign each of three machinists
(labeled 1, 2, and 3)...
asked 27 minutes ago -
Regarding language development, which of the following
statements is FALSE?
Babies are able to cry from...
asked 26 minutes ago -
A couple of small ice cubes at 0 °C are added to glass of warm
water...
asked 24 minutes ago -
Slow 'n Steady, Inc., has a stock price of $30, will pay a
dividend next year...
asked 28 minutes ago -
During the current financial year, the owner of Omega
Enterprises withdrew supplies of $2,000 for personal...
asked 24 minutes ago -
PLEASE SHOW MATH CALCULATION(formulas)it has to be done on excel
P12-4 Last year (2016), Richter Condos...
asked 32 minutes ago -
A 0.25μF capacitor is charged to 50 V . It is then connected in
series with...
asked 49 minutes ago -
Calculate the current, I, through the batteries for:
- a 2-bulb parallel circuit
- How does...
asked 50 minutes ago -
Choose the sentence that uses correct punctuation.
1a. The prefatory parts of a report include the...
asked 56 minutes ago -
For the element arsenic, which one of the following sets of
quantum numbers could not apply...
asked 1 hour ago -
Compare and contrast the architectures of 3 types of ADCs:
Flash, SAR, and pipelined. Use the...
asked 1 hour ago