Adenosine deaminases modify adenosines to form _, which is then read as _____ by the translation...

Question

Question

TTT Phe (F) TTC TCT Ser (S) TCC TCA TCG TAT Tyr (Y) TAC TAA Ter TAG Ter TTA Leu (L) TGT Cys (C) TGC TGA Ter TGG Trp (W) TTG

Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase.

Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions. For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.

I (Ileu) is changed to V (val):

K (Lys) is changed to E (Glu):

T (Thr) is changed to A (ala):

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

Adenosine deaminases modify adenosine to form inosine , which is then read as guanosine by the translation and splicing system, as well as by reverse transcriptase. It generally base pairs with cytosine.

ATT , ATC, ATA code for lle and GTT, GTC, GTA code for val. When A (adenine) is converted to inosine by adenosine deaminase, the machinary will read the codon as GTT. Instead of producing lle, val is produced.
AAA, AAG code for Lys and GAA, GAG code for Glu. If A is converted to inosine, instead of Lys, Glu is produced.
ACT, ACC, ACA and ACG code for Thr and GCT, GCC, GCA and GCG code for ala. If the se happens here also, that is when A is converted to inosine, the translation machinery will read as guanosine and ala is formed instead of Thr.

Add a comment

Answer 2

Similar Homework Help Questions

Adenosine deaminases modify adenosines to form which is then read as

Adenosine deaminases modify adenosines to form which is then read as ___ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions. For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes. (lleu) is changed to V (val): K(Lys) is changed to E (Glu): T (Thr) is changed to A (ala):
Question 11 (1 point) Figure out the mutation. You will need the codon table for this...

Question 11 (1 point) Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a portion of the ORF for a eukaryotic gene and matching amino acid sequence of that portion of its gene product. ATA GTG CGC TGT AGA CTC TAT GCG TCT GAG TCT ACG Ile Val Arg Cys Arg Leu Tyr Ala Ser Glu Ser Thr A mutant is found that has the following protein sequence: lle Val Arg Cys...
Based on the chemical properties of the residues, which of the following sequences could form the...

Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category. Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala

mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following da...

. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15
18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...

18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...

Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the...

Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the following stretches of amino acid residues would you expect to find in the interior of protein molecules? O Gly-Tyr-His-Arg-His O Ala-Val-Leu-lle-Trp O Ala-Asp-Asp-Tyr-Arg O Gly-Lys-Ser-Pro-Thr OPhe-Glu-Gin-Glu-Asn QUESTION 3 2 points Save Answer The observation that proteins often renature into their original conformations after
11.Which of the following mutations would most likely to disrupt the structure of an α-helix? Cys...

11.Which of the following mutations would most likely to disrupt the structure of an α-helix? Cys to Ala Lys to Arg Glu to Gly Val to Leu 12.Which amino acid combination is the most preferred to occupy positions 1 and 4 in an α-helix? Glu and Lys Phe and Pro Lys and Arg Asp and Glu 13.If each turn in the standard alpha helix extends 5.4 A and there are 3.6 amino acid residues per turn, how many amino acids...

all of them please Question 12 (1 point) Which of the following conditions would kill amp'...

all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...

Adenosine deaminases modify adenosines to form _, which is then read as _____ by the translation...

Homework Answers

Add Answer to:
Adenosine deaminases modify adenosines to form _, which is then read as _____ by the translation...

Post as a guest

Earn Coins