Adenosine deaminases modify adenosines to form which is then read as ___ by the translation and splicing systems, as well as by reverse transcriptase.
Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions. For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.
(lleu) is changed to V (val):
K(Lys) is changed to E (Glu):
T (Thr) is changed to A (ala):
B2. Adenosine deaminase modify adenosine to form inosine which is then read as guanosine by translation and splicing systems as well as the reverse transcriptase.
Glycine, arginine, and valine are the residues most often created by editing, and they normally have a destabilizing effect on proteins. Lysine, isoleucine, and glutamate are selected for conversion most frequently, and they normally have a stabilizing influence. Glycine, with its small side chain, is thought to lend greater flexibility or conformational entropy to hinge and helix regions of proteins
Adenosine deaminases modify adenosines to form which is then read as
Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions. For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes. I (Ileu) is changed to V (val): K (Lys) is changed to E (Glu): T (Thr) is changed to A (ala):...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T A C A C C G G T C A G G T G A T C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...
all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...
can you answer those 3 questions Ipuints Save an You have developed a potential new antidepressant drug called Euphoria. The structure is novel and is tested using the Ames test for mutagenicity. The following results are obtained: Sample Number of his+ revertant colonies distilled water distilled water + rat liver enzymes antidepressant antidepressant + rat liver enzymes What conclusion is most consistent with these data? the drug and its conversion products are not mutagenic. rat liver enzymes are mutagenic. the...
C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotides, or codon, is the basic unit of storage. The reason for this is that each gene codes for a protein, and all proteins are made from 20 amino acids. Recall that there are 4 different bases that make up dna. Thus, three bases can encode for 4x4x4 = 64 different symbols. Two base pairs can only encode for 4x4 = 16 symbols, which is...
11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in...