Question
all of them please
Question 12 (1 point) Which of the following conditions would kill amp lac his bacteria? amp = ampicillin (an antibiotic), l
Question 13(1 point) Translate the following short bacterial mRNA sequence below starting at the first start codon you come t
AUG Met ACG J G עי[AGG יעי[AAG G GUU) GCU GUC GCC Val GUA GCA GUG) GCG Ala GAU) GGU GAC) Asp GGC GAA GGA Glu GAG GGG U с А G
Question 14(1 point) Which series of molecular transitions best represents the processes of: 1. replication 2. transcription
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) The given bacteria is ampr, lac+ and his-. What it technically means is that, the bacteria is resistant to ampicillin, an antibiotic, it has the ability to breakdown lactose when it is present as a sole carbon source in the media and that it cannot produce histidine (an important amino acid) and thus it has to be supplied in the media.

The question asks for the scenario where the bacteria is unable to survive. Let's look at the options one by one.

a) The media contains all the components, ampicillin, lactose and histidine. The bacteria will survive in this media.

b) The media contains ampicillin and lactose as sole carbon source. However it does not contain histidine. Since our bacteria is ampr, lac+and his-, it can easily tolerate both amp and lactose. However, being his-, it could not produce histidine and needed it to be suplemented by the media. Since the media does not have histidine, the bacteria will not survive.

The answer is thus: B

2) Translation, the process of conversion of mRNA to protein begins at AUG. Thus the first amino acid is always methonine. However methionine is not always retained after the process of translation is completed. The given sequence can be translated with the help of the chart given. Since the translation begins with AUG, the initial 3 nucleotides are not considered.

The sequence is:

5'- AUG GCC CGA GCA UUU CCG UAA UCA A-3'

The sequence has been split into groups of three to enable easy translation. The resulting amino acid sequence will be:

ala-arg-ala-phe-pro

AUG gets removed after translation, and UCA is the stop codon effectively terminating translation.

The answer is b

3) Replication: replicaation is the precess of duplication of DNA. DNAstrands undergoes unwinding and utilizing the parent strand as the template, makes another copy of itself. Thus replication is DNA to DNA.

Transcription: Transcription is process by which DNA sequence is utilized as a template to synthesize mRNA sequence. The resultign sequence is called a transcript. Thus transcription is DNA to RNA

Translation: Translation is a process by which the mRNA transcript is utilized to form amino acid chain known as polypeptide. Thus translation is RNA to polypeptide.

In order of occurance, it is: DNA to DNA, DNA to RNA and DNA to polypeptide.

The answer to the question is thus: B)

Add a comment
Know the answer?
Add Answer to:
all of them please Question 12 (1 point) Which of the following conditions would kill amp'...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a...

    all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a black body and the wild-type (b+) has a gray body; the mutant vestigial (v) has wings that are short and crumpled compared the long wild-type wings (v+). These genes are linked and are located on the X- chromosome. A cross between a female fly and a black, vestigial winged male fly produced the following progeny: gray (b+), normal (v+) 20 gray (b+), vestigial (v)...

  • all them please Question 1 (1 point) Given the following information: parental phenotypes in the progeny...

    all them please Question 1 (1 point) Given the following information: parental phenotypes in the progeny are a, b c, and a+, b+, C+, and the double recombinant phenotypes are a+, b, C+ and a, b+, c what is the gene order? A) b--a-- B) a--b-c C) a--C--b ហា Question 5 (1 point) What embryonic event gives rise to calico cats? OA) Y inactivation B) x inactivation C) chromosomal non-disjunction D) meiosis Question 3 (1 point) Two parents without sickle...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • For the following DNA strand, what is the amino acid chain that would result in the cell?

    For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT