Question


18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC T

18 please
15. Answer the following questions 15, 16, 17, and 18 that are linked. DNA: TAC CCT GAG AGA GAC ACT 5 First SATG GGA CTC TCT
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Q15b.5' AUGGGACUCUCUCUGUGA3'

Q16a.CUC is the third codon of the mRNA.

Q16b.GAG is the third anti codon.

Q16c. Leu (Leucine) is attached to tRNA.

Q18b. Yes, the mutation changes the amino acid sequence therefore the new mRNA sequence is: 5'AUGCGACUCUCUCUGUGA3' this the codon sequence for the amino acid sequence

Q18c. Yes, the mutation changes the way the protein functions because a single change in the nucleotide base leads to a change in the amino acid it codes for therefore change in a single amino acid in a long polypeptide chain leads to improper folding of the protein which is newly formed and thus leads to a truncated version of the protein.

Q18d.Since the mutation causes the truncated version of a protein this creates malfunctioning of the protein or no functioning of the protein (absence of that protein itself). Always it is not the genes that cause diseases, but the genetic disorders are result of mutations which makes the genes to function improperly. But in certain conditions there are chances for the body to rectify the problem by repair mechanisms.

Add a comment
Know the answer?
Add Answer to:
18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...

    Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions.  For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.   I (Ileu)  is changed to V (val): K (Lys) is changed to E (Glu): T (Thr) is changed to A (ala):...

  • I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES...

    I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met…             Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of...

    please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of the nucleotides. what type of mutation is this? what is the resulting polypeptide sequence? 3'- GTT - TAC - CTT - -CTC--TCC -TCA -GAC - ATC -GCA -5' (template strand) 5' - CAA - ATG - GAA - -GAG--AGG - AGT - CTG- TAG - CGT - 3' (non-template/coding strand) answer: It's a ___________________mutation. Final polypeptide sequence is N' - Met - GLU _______________    ...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT