Answer 1
As we know, DNA is composed of 4 nucleotides (A, T, C or G). If we have total 15 nucleotides then these 15 nucleotides combine to form a DNA sequence of 15 nucleotide length.
Number of different DNA sequence generated from a DNA sequence composed of 15 nuceotides are : 4n (where n is number of nucleotides present).
Here n is 15, So, 415 DNA sequences can be generated.
Answer 2
As we know, total 20 types of amino acids are present in a protein sequence. If we have total 15 amino acids then 15 amino acids combine to form different possible polypeptide chains. According to the formula, number of different polypeptide generated from a protein sequence composed of 15 amino acids are:
20n = 20 15 (where n = 15).
So, total 20 15 polypeptide can be generated from 15 amino acids of 15 amino acid length.
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
PLEASE HELP! When DNA is decoded into protein the 'letters' of the DNA sequence are 'read' in ordered triplets. For example, the sequence 'ACGTACTTA' would be read as the three ordered triplets 'ACG,' 'TAC,' and 'TTA.' Each letter can be either G, T, C, or A and each distinct triplet can code for a different protein subunit called an amino acid. How many different amino acids can be coded for?
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.
Match what is composed of what 1) RNA is composed of ____ 2) DNA 3) Proteins 4) Triacyglycerol 5)Glycogen 6)Fats 7)Protein 8)Starch a) lipids b) ribonucleotides c) amino acids d) deoxyribonucleotides e) glucose f) nucleotides g) glucose monomers h) protein
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...