Question

We all know that the DNA molecules are double-stranded in living cells. Please design a Java program to prompt the user to enter a DNA sequence and then find the complement sequence of that DNA sequence, and print out a double-stranded DNA with the complement strand right beneath the original DNA sequence. See the sample output below.

Sample output:
Here is the starting DNA:

ACGGGAGGACGGGAAAATTACTACGGCATTAGC

Here is the double-stranded DNA:

ACGGGAGGACGGGAAAATTACTACGGCATTAGC
TGCCCTCCTGCCCTTTTAATGATGCCGTAATCG

Answer 1

Screenshot of program:

ScreenShot of Output:

Source Code:

import java.util.Scanner;

public class ComplementDNA {
   public String complement(String dna_strand) {
       StringBuilder complement = new StringBuilder();
      
   for(int i=0;i<dna_strand.length();i++){
   char c = dna_strand.charAt(i);
  
   // if 'T' is at ith index in dna_strand then add 'A' inplace of 'T' in complement StringBuilder
   if(dna_strand.charAt(i) == 'T'){
       complement.append('A');
   }
  
   // if 'A' is at ith index in dna_strand then add 'T' inplace of 'A' in complement StringBuilder
   if(dna_strand.charAt(i) == 'A'){
       complement.append('T');
   }
  
   // if 'C' is at ith index in dna_strand then add 'G' inplace of 'C' in complement StringBuilder
   if(dna_strand.charAt(i) == 'C'){
       complement.append('G');
   }
  
   // if 'G' is at ith index in dna_strand then add 'C' inplace of 'G' in complement StringBuilder
   if(dna_strand.charAt(i) == 'G'){
       complement.append('C');
   }
  
   // if 'U' is at ith index in dna_strand then add 'A' inplace of 'U' in complement StringBuilder
   if(dna_strand.charAt(i) == 'U'){
       complement.append('A');
   }
   }
   return complement.toString();
   }
  
   public static void main(String[] args) {
       ComplementDNA obj = new ComplementDNA();

       Scanner in = new Scanner(System.in);
       // giving prompt to user to enter the dna sequence
       System.out.println("Please enter a DNA sequence :");
       String dna = in.nextLine();
      
       String complementedDNA = obj.complement(dna);
       System.out.println("Here is the double-stranded DNA :");
       System.out.println(dna);
       System.out.println(complementedDNA);
   }
}