Question

Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene?  How can...

Here is a DNA sequence obtained from sequencing.

  1. Does this sequence code for a gene?  How can you tell?
  2. Is this a eukaryotic or prokaryotic gene? How can you tell?
  3. If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell.
  4. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

1):

  • Yes. The given sequence codes for a protein.
  • It contains an open reading frame (A start and stop codon with intervening amino acid coding sequences).

2):

  • Most likely, the given sequence codes for a prokaryotic protein as it does not contain any introns.

3):See image.


4):

  • There are no regulatory elements in the given sequence.
  • There is a 2 bp sequence upstream to the start codon and 3 bp sequence downstream to the stop codon.
  • The remaining sequence is the ORF.

Please Rate My Answer.......Thank.......u...

Add a comment
Know the answer?
Add Answer to:
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene?  How can...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods...

    Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • An F' plasmid from an exotic marine bacterium that can degrade petroleum when mated with an...

    An F' plasmid from an exotic marine bacterium that can degrade petroleum when mated with an F-E. coli that cannot degrade petroleum results in an E. coli F' that can degrade petroleum. After sequencing the F' plasmid and comparing it to the F sequence, you see that it has about 6000 base pairs of additional DNA. You suspect that there is a gene in that sequence that encodes a protein that degrades petroleum. Describe how you would use reverse genetics...

  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

  • A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that...

    A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that has been fused to a gene that encodes a protein that is easily observed experimentally. Why is this approach useful? a. It provides information on the binding interactions of the gene product. b. It provides information into where and when a gene is expressed. c. It can provide information as to where a gene is expressed. d. It can provide information as to when...

  • Eukaryotic genes can be introduced into bacteria by recombinant DNA techniques. If the introduced gene encodes...

    Eukaryotic genes can be introduced into bacteria by recombinant DNA techniques. If the introduced gene encodes a protein that is also found in bacteria—for example, a universally used glycolysis enzyme—then expression of the eukaryotic gene may produce a protein that functions in the bacterial cell. In an experiment, the entire mouse gene for a glycolysis enzyme, including its promoter, coding regions and termination sequence, is introduced into an E. coli cell that has a mutant gene for the bacterial version...

  • How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...

    How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...

  • You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

    You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • Question 1 Match the term with the best definition or description; most topics relate to the...

    Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT