Question

1 Targeted Gene SBDNA sequence 2 HEATRİ AGATGGCTCACCAATGGCGA GGCCGACTGGCACTCAGGAC CAGTCAGCTAGCAAAAACCT AGTCCAAGGCTCTAATCCCA AGTCCTCATAGTTCACCACC AGACCATTGCCAGTGTTCGT TAAGCCAGCACAGAAGTGTC GTAGGCCAGCACGTGCTCCC TCGATTGTGGCCGCTTCCTT AAAGCTTCATAAGTTTGAGT TAGCACTCACCTACGAACAC AGGGACACCGCCTTCGCCAT CGGcCCCTITGAGGTCAACA CCGCAGCGAGAGCGACGCGT TTGGTGATGCGGTCGTACTT CTCCCGATACCGTCAGACCC GCAGGGTGGCCGTCGTGACC TGGCCCCCCTTCGAGGGCCA AGTAGAGTACGAGCTTCCAC CCAGTCGTTCGGCTGCTGCG CAATTCCAAGCAACTCTTCC AGTCGTCGAGCTGATGAAGA CTTACCAGAACGTTGTTTTC TAACCTTGGGATTAGAGCCT CCGGTTCATGCCGCCCATGC ACTTCCTGAAAACAACGTTC CCCGCGTGACCAGTCATTTG 5.13 1.11E-14 4.89 1.69E-07 4.04 2.48E-08 .65 1.11E-06 .11 4.11E-27 61 5.60E-13 .60 0.020025 2.17 7.28E-05 14 0.000116 98 0.03739 95 0.005348 .60 0.000206 0.64 0.347273 0.50 0.615265 0.50 0.583591 0.28 0.708809 0.23 0.826464 4 HEATR1 S POLR2D 7 POLR2D 8 HEATR1 10 HEATR1 11 POLR2D 12 POLR2D 13 HEATR1 14 MCM2 5.25 16 MCM2 17 GRIP1 20 GRIPI 0.18 0.843931 .25 0.805664 0.48 0.161874 0.85 0.463436 30 1.95E-25 3.28 3.91E-18 3.29 4.26E-28 3.36 3.45E-16 3.58 1.79E-57 3.72 5.11E-51 4.64 6.29E-29 42.44 4.72 1.31E-61 581 1.35E-73 6.61 2.07E-63 7.44 5.21E-49 22 HEATR1 25 POLR2D 164.4 193.17 242.40 231.41 349.24 28 CREBBP 9 CREBBP 0 CREBBP 1 CREBBP TCGACAATGCGGGAGCGAGC 135.07 440.20 54.25 AGCGGCTCTAGTATCAACCC GAATCACATGACGCATTGTC 735.97 1367.24 ATTCCACGGGAAGGAGATCT 57.99 1558.14 1632.13 83.134515.31 4547.53 99.659745.30 9814.11 15.28 2480.03 2696.65 CATGTGTAACAGTTCCTGCA AAACATCTCGTACAGTGACA CCTGGCTTCTTACGCCGTCC GTACTGCAGTCCAAAGAACC 100.73 37 Here is a description of each of the columns: A) Targeted Gene B) Guide sequence (this is a DNA sequence because it is the sequence encoded in the plasmid) C) logFC: log (base 2) difference in number of guides sequenced at Day 21 vs. Day 0. Negative means the number of guides is less at Day 21, positive means the number of guides increases after 21 days. D) FDR: False discovery rate: a statistical measure of how likely it is that the Day 21 guide counts are statistically different from the Day 0 guide counts. An FDR

Answer 1

Each time point has 2 replicates. Two readings each for day 0 and day 21.

HEATR1 is targeted by most guides. It has in total 6 guides. Other genes have either 5 or 4 guides.

Out of the three given genes, the guides to HERT1 have decreased over 21 days. This means the gene is essential during The period and hence is allowed to express. Hence HEART1 is the essential gene.

MCM2 expression is increased by decreasing the level soft guides for it. So it is needed for rapid cell division. Hence it is the limiting factor or essential factor for cell division.

GRIP1 expression does not change significantly in 21 days, hence it does not affect the growth of cells.